journal menu
![[Figure 8]](qh5070fig8mag.jpg)
|
|
Figure 8
Key residues of STF-HD for DNA binding and in vivo function. (a) EMSA showing that mutations in STF-HD affect its ability to bind to the MtAS2 promoter sequence in vitro. (b)–(g) Phenotypes of N. sylvestris plants: lam1 mutant (b), plants complemented with wild-type STF:STF corresponding to the WT phenotype (c), mutants STF:STF-R96A (d), STF:STF-R113Q (e), STF:STF-K155A/R156A/R157A (f), STF:STF-R113Q/K155A/R156A/R157A (g). (h) EMSA showing that the R151A mutation nearly abolished the binding of STF to the TGA sequence (GCAAATCTATGATCTATTCAAG). (i) EMSA showing that the R151A mutation still retained its binding to the TAAT sequence (GCAAATTAATTATTTATTAAAG). (j) Phenotype of a lam1 mutant N. sylvestris plant complemented with STF:STF-R151A. (k) Leaf length/width ratios of the largest leaves of six-week-old plants. At least ten independent lines were analyzed for each construct. Statistical analyses were performed using one-way ANOVA followed by a Tukey's test (p < 0.05). |
![[Figure 8]](qh5070fig8.jpg)
 | STRUCTURAL BIOLOGY |
ISSN: 2059-7983
Open 
access
access
