laboratory communications\(\def\hfill{\hskip 5em}\def\hfil{\hskip 3em}\def\eqno#1{\hfil {#1}}\)

Journal logoSTRUCTURAL BIOLOGY
COMMUNICATIONS
ISSN: 2053-230X
Volume 67| Part 9| September 2011| Pages 1027-1031

Wheat germ cell-free expression system as a pathway to improve protein yield and solubility for the SSGCID pipeline

CROSSMARK_Color_square_no_text.svg

aSeattle Biomedical Research Institute, USA, and bDepartment of Global Health, University of Washington, USA
*Correspondence e-mail: [email protected]

(Received 2 March 2011; accepted 8 August 2011; online 31 August 2011)

Recombinant expression of proteins of interest in Escherichia coli is an important tool in the determination of protein structure. However, lack of expression and insolubility remain significant challenges to the expression and crystallization of these proteins. The SSGCID program uses a wheat germ cell-free expression system as a rescue pathway for proteins that are either not expressed or insoluble when produced in E. coli. Testing indicates that the system is a valuable tool for these protein targets. Further increases in solubility were obtained by the addition of the NVoy polymer reagent to the reaction mixture. These data indicate that this eukaryotic cell-free expression system has a high success rate and that the addition of specific reagents can increase the yield of soluble protein.

1. Introduction

1.1. Protein expression

An impediment to the successful production of large quantities of natively folded proteins in Escherichia coli is the tendency of many proteins to become insoluble when overexpressed. In order to successfully produce quantities of these proteins sufficient for crystallization, additional methods are necessary; in vitro systems using other organisms as well as cell-free systems utilizing extracts from prokaryotic or eukaryotic organisms have been developed (Gräslund et al., 2008[Gräslund, S. et al. (2008). Nature Methods, 5, 135-146.]; Endo & Sawasaki, 2006[Endo, Y. & Sawasaki, T. (2006). Curr. Opin. Biotechnol. 17, 373-380.]). Eukaryotic systems utilize a protein-folding apparatus that has evolved to direct the folding of more complex proteins, while cell-free systems are not dependent on the survival of a cell (Klammt et al., 2006[Klammt, C., Schwarz, D., Löhr, F., Schneider, B., Dötsch, V. & Bernhard, F. (2006). FEBS J. 273, 4141-4153.]).

Prokaryotic cell-free systems exist, although these systems have demonstrated limited improvement over prokaryotic in vivo methods; the misfolding of proteins remains a significant problem (Hillebrecht & Chong, 2008[Hillebrecht, J. R. & Chong, S. (2008). BMC Biotechnol. 8, 58.]). The wheat germ cell-free expression system combines the advantages of cell-free and eukaryotic systems and is well suited for expression of difficult-to-express proteins such as disulfide-bond-containing or integral membrane proteins (Endo & Sawasaki, 2006[Endo, Y. & Sawasaki, T. (2006). Curr. Opin. Biotechnol. 17, 373-380.]; Kawasaki et al., 2003[Kawasaki, T., Gouda, M. D., Sawasaki, T., Takai, K. & Endo, Y. (2003). Eur. J. Biochem. 270, 4780-4786.]; Spirin, 2004[Spirin, A. S. (2004). Trends Biotechnol. 22, 538-545.]; Vinarov, Loushin Newman & Markley, 2006[Vinarov, D. A., Loushin Newman, C. L. & Markley, J. L. (2006). FEBS J. 273, 4160-4169.]; Vinarov, Loushin Newman, Tyler et al., 2006[Vinarov, D. A., Loushin Newman, C. L., Tyler, E. M., Markley, J. L. & Shahan, M. N. (2006). Current Protocols in Protein Science, ch. 5, unit 5.18. New York: Wiley.]; Klammt et al., 2006[Klammt, C., Schwarz, D., Löhr, F., Schneider, B., Dötsch, V. & Bernhard, F. (2006). FEBS J. 273, 4141-4153.]; Tyler et al., 2005[Tyler, R. C. et al. (2005). Proteins, 59, 633-643.]). This system has been used as a rescue pathway for human proteins that are not soluble in both in vivo and in vitro E. coli systems (Langlais et al., 2007[Langlais, C., Guilleaume, B., Wermke, N., Scheuermann, T., Ebert, L., LaBaer, J. & Korn, B. (2007). BMC Biotechnol. 7, 64.]).

A recent analysis of in vivo and in vitro expression of Arabidopsis thaliana proteins found that 95–97% of a set of protein targets were soluble when expressed via a wheat germ cell-free system in com­parison to 40% when expressed using the E. coli cell-based system (Langlais et al., 2007[Langlais, C., Guilleaume, B., Wermke, N., Scheuermann, T., Ebert, L., LaBaer, J. & Korn, B. (2007). BMC Biotechnol. 7, 64.]). These two systems were also tested on a Plasmodium falciparum protein set and while detectable protein was obtained for 30% of the proteins in E. coli, protein was obtained for 75% when expressed in the eukaryotic cell-free system (Tyler et al., 2005[Tyler, R. C. et al. (2005). Proteins, 59, 633-643.]). Thus, eukaryotic in vitro systems, specifically the wheat germ cell-free system, hold significant promise.

1.2. Solubility

There is extensive literature on the variables leading to insoluble recombinant expression of proteins. Protein aggregation remains a significant problem in E. coli expression systems. Tags used to purify proteins often affect the solubility, and the addition of various tags can lead to the soluble expression of a previously insoluble protein (Gordon et al., 2008[Gordon, E., Horsefield, R., Swarts, H. G., de Pont, J. J., Neutze, R. & Snijder, A. (2008). Protein Expr. Purif. 62, 1-8.]; Ohana et al., 2009[Ohana, R. F., Encell, L. P., Zhao, K., Simpson, D., Slater, M. R., Urh, M. & Wood, K. V. (2009). Protein Expr. Purif. 68, 110-120.]; Sun et al., 2011[Sun, P., Tropea, J. E. & Waugh, D. S. (2011). Methods Mol. Biol. 705, 259-274.]). Modification of the sequence, such as the addition of highly acidic sequences, can also solubilize a previously insoluble protein (Zhang et al., 2004[Zhang, Y.-B., Howitt, J., McCorkle, S., Lawrence, P., Springer, K. & Freimuth, P. (2004). Protein Expr. Purif. 36, 207-216.]) and different tags may affect solubility (Widakowich et al., 2011[Widakowich, G., Zhang, C., Harris, S., Mitri, K., Powers, G., Troung, K.-S. & Hearn, M. T. (2011). Biotechnol. Prog. 27, 1048-1053.]). Proteins with similar features in their native sequences may have a greater tendency towards solubility when recombinantly expressed in vivo. The frequency of individual amino acids as well as the frequency of different types of amino acids within a protein has been shown to affect in vivo solubility in E. coli. It is likely that secondary structure also plays a role in protein solubility and the tendency to form amyloid bodies in vivo (Idicula-Thomas & Balaji, 2005[Idicula-Thomas, S. & Balaji, P. V. (2005). Protein Eng. Des. Sel. 18, 175-180.], 2007[Idicula-Thomas, S. & Balaji, P. V. (2007). In Silico Biol. 7, 225-237.]). If the protein produced in E. coli is primarily insoluble, denaturing and refolding can be attempted. Common denaturing reagents include guanidinium and urea. The refolding process can be aided by the addition of stabilizing agents such as L-arginine (Kudou et al., 2011[Kudou, M., Ejima, D., Sato, H., Yumioka, R., Arakawa, T. & Tsumoto, K. (2011). Protein Expr. Purif. 77, 68-74.]). Cell-free systems have an additional advantage in the production of soluble protein, as agents that aid in protein folding can be directly added to the translation reaction. Eukaryotic expression systems, including the wheat germ cell-free system, have been demonstrated to raise the solubility of a protein (Dadashipour et al., 2011[Dadashipour, M., Fukuta, Y. & Asano, Y. (2011). Protein Expr. Purif. 77, 92-97.]; Klammt et al., 2006[Klammt, C., Schwarz, D., Löhr, F., Schneider, B., Dötsch, V. & Bernhard, F. (2006). FEBS J. 273, 4141-4153.]; Langlais et al., 2007[Langlais, C., Guilleaume, B., Wermke, N., Scheuermann, T., Ebert, L., LaBaer, J. & Korn, B. (2007). BMC Biotechnol. 7, 64.]).

2. Materials and methods

2.1. Protein selection

Proteins in this analysis are a subset of protein targets entered into the Seattle Structural Genomics Center for Infectious Disease (SSGCID) pipeline. The target organisms were NIAID category A–C pathogens. Proteins within target organisms were selected bioinformatically for homology to current drug targets or nominated for structure determination by the scientific community. Proteins were eliminated if they contained more than eight cysteines or a predicted transmembrane domain in the absence of a signal peptide. A total of 44 proteins were used in this analysis, a summary of which can be found in Table 1[link]. Most of the proteins in this set `failed' expression or solubility testing in E. coli; targets were classified as `failed' if low levels of soluble protein were obtained on expression in the standard E. coli conditions for SSGCID (Myler et al., 2009[Myler, P. J., Stacy, R., Stewart, L., Staker, B. L., Van Voorhis, W. C., Varani, G. & Buchko, G. W. (2009). Infect. Disord. Drug Targets, 9, 493-506.]).

Table 1
Protein set used in this analysis

Solubility in E. coli reflects testing; ND, no data. Expression and solubililty ratings reflect small-scale expression using WEPRO1240H. Expression key: −, less than 15 µg µl−1; +, less than 0.30 µg µl−1; ++, less than 0.75 µg µl−1 but greater than 0.30 µg µl−1; +++ greater than 0.75 µg µl−1 Solubility key: −, no soluble protein; +, less than 25% total protein soluble; ++, 25–75% total protein soluble; +++, greater than 75% total protein soluble.

Species Accession ID Sequence cloned Annotation Solubility in E. coli in vivo Cell-free expression Cell-free solubility
Anaplasma marginale ACR67103.1 Full length Major surface protein 2 variant 9H1 ND + −
Anaplasma marginale ACR67104.1 Full length Major surface protein 2 ND − −
Anaplasma marginale ACR67105.1 Full length Major surface protein 2 variant E6F7/1/2 ND + −
Bartonella henselae YP_033889.1 Full length UDP-3-O-(3-hydroxymyristoyl) N-acetylglucosamine deacetylase Insoluble +++ ND
Bartonella henselae YP_032889.1 Full length ABC transporter/ATP-binding protein Insoluble ++ ++
Bartonella henselae YP_034187.1 Full length Holliday junction DNA helicase B Insoluble ++ +
Bartonella henselae YP_033595.1 Full length DNA topoisomerase IV subunit B Insoluble + −
Bartonella henselae YP_033416.1 Full length Hypothetical protein Insoluble ++ −
Borrelia burgdorferi NP_212600.1 Full length Holliday junction DNA helicase B No expression ++ ++
Brucella melitensis YP_419002 Full length Catalase Insoluble ++ +
Brucella melitensis YP_419049 Full length ATP/GTP-binding site motif A (P-loop):ABC transporter:AAA ATPase:TOBE domain Insoluble ND ND
Brucella melitensis YP_414617 Full length ATP/GTP-binding site motif A (P-loop):ABC transporter:AAA ATPase:TOBE domain No expression ++ ++
Brucella melitensis YP_414349 Full length Acetyl-CoA carboxylase, biotin carboxylase:carbamoyl-phosphate synthase L chain, ATP-binding:carbamoyl-phosphate synthetase l No expression ++ +
Brucella melitensis YP_419065 Full length Blue (type 1) copper domain:blue (type 1) copper protein:amicyanin:plastocyanin No expression + −
Brucella melitensis YP_419020 Full length Glutamate decarboxylase α Insoluble + −
Brucella melitensis YP_415432 Full length Thioredoxin:thioredoxin type domain:thioredoxin domain 2 Soluble ++ ND
Burkholderia pseudomallei YP_333769 Full length Thioredoxin 1 Soluble ++ ++
Burkholderia pseudomallei YP_334416.1 Full length Chorismate mutase No expression ++ ++
Burkholderia pseudomallei ZP_04891863.1 267–404 Hemagglutinin-family protein Insoluble ++ ++
Burkholderia pseudomallei YP_331616.1 Full length Branched-chain amino-acid ABC transporter, ATP-binding protein Insoluble ++ +++
Burkholderia pseudomallei YP_334791.1 Full length 30S ribosomal protein S9 No expression − −
Burkholderia pseudomallei YP_334870 Full length 3-Dehydroquinate dehydratase Insoluble + +++
Burkholderia pseudomallei YP_332852 Full length NADH dehydrogenase subunit I Insoluble + +++
Burkholderia pseudomallei YP_334097 Full length Phosphopyruvate hydratase Insoluble + ND
Burkholderia pseudomallei ABA48070.1 Bp 90–510 Sensor histidine kinase Insoluble ++ ++
Burkholderia pseudomallei YP_333873 Full length ATP-dependent protease ATP-binding subunit No expression + −
Burkholderia pseudomallei YP_334398.2 Full length Adenosine deaminase Soluble +++ ND
Burkholderia pseudomallei YP_334535.1 Full length dTDP-glucose 4,6-dehydratase Soluble ++ ND
Burkholderia pseudomallei YP_333748 Full length Histidyl-tRNA synthetase Soluble − −
Ehrlichia ruminantium YP_196632.1 Bp 96–891 FAD-dependent thymidylate synthase ND + ++
Ehrlichia ruminantium YP_196632.1 Bp 96–762 FAD-dependent thymidylate synthase ND + ++
Ehrlichia ruminantium YP_196632.1 Bp 96–654 FAD-dependent thymidylate synthase ND ++ +
Leishmania infantum XP_001464664.1 Full length Elongation factor 1α Insoluble + −
Mycobacterium tuberculosis NP_216165.1 Full length Phenylalanyl-tRNA synthetase subunit α Insoluble +++ +
Mycobacterium tuberculosis NP_216786.1 Bp 57–525 Lipoprotein lppN ND ++ +++
Mycobacterium tuberculosis NP_217463.1 Full length Probable polyketide synthase PKS15 No expression ++ ++
Rickettsia conorii NP_360910.1 Bp 3219–4419 190 kDa cell-surface antigen Insoluble +++ ++
Rickettsia prowazekii AAF34121.1 Bp 1–1095 OmpB Insoluble ++ +
Rickettsia prowazekii NP_221145 Full length NADH dehydrogenase subunit I Insoluble ND ND
Rickettsia rickettsii P15921.1 3900–4953 Outer membrane protein A Insoluble ++ +++
Rickettsia rickettsii YP_001650445.1 Full length Outer membrane protein B ND ++ +
Rickettsia rickettsii AAQ82709.1 3900–4953 Outer membrane protein A ND + +
Trypanosoma brucei XP_822456.1 Full length Hexokinase Insoluble + −

2.2. Cloning

DNA of the target proteins was cloned into the pAVA0421 vector via ligation-independent cloning (LIC) and grown on LB–carbenicillin plates. The pAVA0421 vector contains an N-terminal hexahistidine affinity tag (MAHHHHHH) for imobilized metal-ion affinity chromatography (IMAC). Plasmids were purified using a GenElute HP Plasmid Mini-Prep Kit (Sigma–Aldrich, Dallas, Texas, USA) and transformed into E. coli BL21 (DE3) Rosetta cells (EMD Chemicals, San Diego, California, USA) for expression screening. Small-scale protein expression was carried out and evaluated by Western blotting. All constructs were sequenced in the forward direction to confirm that the correct protein target had been cloned.

DNA templates were obtained from the SSGCID pipeline (Myler et al., 2009[Myler, P. J., Stacy, R., Stewart, L., Staker, B. L., Van Voorhis, W. C., Varani, G. & Buchko, G. W. (2009). Infect. Disord. Drug Targets, 9, 493-506.]). Following E. coli in vivo expression trials, PCR products of the target gene including the six-His tag were amplified from the pAVA0421 vector. The PCR products were then cloned into the cell-free expression vector pEU-E01-LIC1 (pEU-LIC), which had previously been modified to accommodate ligation-independent cloning. Targets were PCR-amplified from the prokaryotic expression vector with RedTaq (Sigma, St Louis, Missouri, USA) using the primers F, CTCACCACCACCACCACCATATG, and R, ATCCTATCTTACTCACTTAGCAGCCGGATCCTCGAG, inserted into pEU-LIC using ligation-independent cloning and transformed into Top10 cells (Invitrogen, Carlsbad, California, USA), which were then grown on LB–carbenicillin plates. Individual colonies were screened for insertion via colony PCR. DNA from the positive clones was maxi-prepped (Sigma, St Louis, Missouri, USA) and the full insert was sequenced in both the forward and reverse directions to confirm that the correct sequence had been cloned and that the insert was free of mutations.

2.3. Expression and solubility testing

Transcription reactions for small-scale screening were performed in PCR strip tubes. In each of the reaction tubes, 2 µg plasmid DNA was mixed with transcription buffer (80 mM HEPES–KOH pH 7.8 containing 20 mM MgCl2, 2 mM spermidine hydrochloride, 10 mM dithiothreitol), 3 mM NTP mix, 2.4 U µl−1 SP6 RNA polymerase and 1.2 U µl−1 RNase inhibitor; RNase-free water was used to bring the final volume to 20 µl. Transcription reactions were then incubated for 4–6 h at 310 K. A Microcon YM-30 filter (Millipore, Billerica, Massachusetts, USA) was used for small-scale mRNA clean-up.

Small-scale translation reactions were performed in 96-well plates and synthesized RNA was added to the translation mixture; large-scale reactions were performed using either the Protemist DT II robot (Cell Free Sciences, Yokohama, Japan), which also performs sequential transcription, translation and purification steps, or the Protemist XE robot (Cell Free Sciences, Yokohama, Japan), a robot that performs continuous translation for high yields of protein production. Small-scale and large-scale translations were performed using WEPRO1240H (Cell Free Sciences, Yokohama, Japan) cell extract according to the manufacturer's instructions. For large-scale purification, the translation mixture was clarified by centrifugation at 6000 rev min−1 for 30 min at 277 K. The supernatant was purified by IMAC using a HisTrap FF 5 ml column (GE Biosciences, Piscataway, New Jersey, USA) equilibrated with binding buffer consisting of 25 mM HEPES pH 7.0, 300 mM NaCl, 5% glycerol, 30 mM imidazole, 1 mM tris(2-carboxyethyl)phosphine (TCEP) and eluted with 500 mM imidazole in the same buffer. Concentrated pure protein was flash-frozen in liquid nitrogen and stored at 193 K. Additional translations were performed using WEPRO7240H extract (Cell Free Sciences, Yokohama, Japan) according to the manufacturer's instructions. For selected protein targets, NVoy (also known as NV10), a commercially available linear carbohydrate-based polymer of 5 kDa molecular weight (Expedeon, San Diego, California, USA), was used to improve solubility yields. NVoy was added directly to the translation-reaction mixture in the Protemist XE system at a concentration of 1 mg ml−1. Solubility was assessed in the presence and the absence of the NVoy polymer.

From the translation reaction, two 10 µl aliquots were taken. The total protein from the first aliquot was mixed with 10 µl sample buffer. The other aliquot was spun in a microcentrifuge at top speed for 60 s; the supernatant (soluble) was separated from the pellet and mixed with 10 µl sample buffer, while the pellet (insoluble) was resuspended in 20 µl sample buffer. All samples were boiled at 368 K for 10 min and 10 µl of each sample was loaded onto a gradient SDS–PAGE gel (Pierce Bioscience, Rockford, Illinois, USA) for analysis. Gels were stained with SimplyBlue SafeStain (Invitrogen, Carlsbad, California, USA) and expression levels were based on visual inspection of the SDS–PAGE gels and scaling the intensity of the expected protein bands. The identities of the hexahistidine-tagged proteins were confirmed by Western blotting using an anti-His antibody (Qiagen, Valencia, California, USA). In addition to confirming that the protein was of the correct size, the protein molecular-weight standard (Bio-Rad, Hercules, California, USA) was used as a reference for the quantity of His-tagged protein. Briefly, the approximate quantity of protein in each marker band was estimated and the band intensities of the His-tagged proteins were then compared with the marker proteins. A `high' expression score (+++) corresponded to greater than 0.75 µg µl−1 target protein in the reaction mixture. A `medium' expression rating (++) corresponded to more than 0.30 µg µl−1 but less than 0.75 µg µl−1 and a `low' expression rating (+) corresponded to a visible band of less than 0.30 µg µl−1. A `no detectable protein' rating (−) corresponded to no detectable expression on either SDS–PAGE or Western blot gels.

Ratings of the solubility were also determined by visual inspection of the protein bands on SafeStained SDS–PAGE gels using a system similar to that employed for the scoring of expression. The ratio of the band intensities resulting from the pairs of soluble and insoluble proteins was used to rate solubility. A high solubility score (+++) was assigned when 75–100% of the total protein was in the soluble fraction. A medium solubility rating (++) was assigned when the soluble and the insoluble fractions were approximately equal in band intensity. A low solubility rating (+) was assigned when less than 25% of the total protein intensity was in the soluble fraction. Samples with an absence of detectable soluble protein were assigned an insoluble rating (−).

3. Results

3.1. Small-scale expression

A total of 44 protein targets were analyzed. Two were from eukaryotic organisms (Trypanosoma brucei and Leishmania infantum); the remainder originated in prokaryotes (the genera Anaplasma, Bartonella, Borrelia, Brucella, Burkholderia, Ehrlichia and Mycobacterium). In this set, 20% of the protein targets were soluble when expressed in E. coli, 52% were insoluble and the remaining 22% were not expressed (Table 1[link]). The first stage of the wheat germ cell-free expression pipeline was designed for small-scale screening. During these tests, detectable protein was achieved for 87% of targets based on Western blot analysis (Tables 1[link] and 2[link]). 83% of the targets expressing insoluble protein in E. coli expressed soluble protein in the cell-free system (Table 1[link]). These data demonstrate that the wheat germ cell-free expression system is effective at production of soluble protein.

Table 2
Summary of protein-expression level and solubility from the cell-free expression system using small-scale expression, the Protemist DT II and the Protemist XE robotic platforms

Conditions included WEPRO1240H and 7240H cell-free extracts in the presence and absence of NVoy. 1240H, WEPRO1240H extract; 7240H, WEPRO7240H extract; (−), without NVoy; (+), with 1 mg ml−1 NVoy.

  Small-scale screening Protemist DT II Protemist XE
  1240H, (−) 1240H, (+) 1240H, (−) 1240H, (+) 7240H, (−) 7240H, (+) 1240H, (−) 1240H, (+) 7240H, (−) 7240H, (+)
No. of targets 44 — 29 5 6 5 4 1 4 2
Any expression (%) 87 — 97 80 67 80 100 100 100 100
Soluble expression (%) 56 — 59 80 17 80 75 100 50 100

3.2. Large-scale expression

A collection of 29 proteins were selected from the first set of robust small-scale-screened targets for further scaling up in the Protemist DT II using WEPRO1240H extract. (Transcription and translation reactions as well as affinity purification are performed sequentially in the robot.) From this set, 28 targets produced detectable protein, with medium to high quantities of protein for 17 of these targets (Table 2[link]). Additionally, the small-scale expression testing successfully predicted the expression level and degree of solubility of proteins produced on the large scale in the DT II robot (data not shown). Of the 29 targets, five with varying levels of solubility were selected for testing in the Protemist XE robot with WEPRO7240H cell-free extract, which has been optimized for high-level expression of His-tagged proteins using the Protemist XE (Table 3[link]). Of the five proteins tested in this system, large quantities of protein were obtained for four (Table 3[link], data not shown), although only small quantities of the protein were soluble. Small quantities of the fifth protein were produced, but these quantities were sufficient for crystallization using the microcapillary method (Gerdts et al., 2008[Gerdts, C. J., Elliott, M., Lovell, S., Mixon, M. B., Napuli, A. J., Staker, B. L., Nollert, P. & Stewart, L. (2008). Acta Cryst. D64, 1116-1122.]; Yadav et al., 2005[Yadav, M. K., Gerdts, C. J., Sanishvili, R., Smith, W. W., Roach, L. S., Ismagilov, R. F., Kuhn, P. & Stevens, R. C. (2005). J. Appl. Cryst. 38, 900-905.]). As a result, additional methods were necessary to produce significant quantities of soluble protein.

Table 3
Summary of large-scale expression data in the presence or absence of NVoy

Numbers indicate the numbers of milligrams of soluble protein purified in a 1 ml reaction cup on the Protemist DT II from each run. (+) and (−) indicate the presence or absence of NVoy at a concentration of 1 mg ml−1.

          NVoy (+):NVoy (−) ratio 7240H:1240H ratio
Protein 1240H, NVoy (−) 1240H, NVoy (+) 7240H, NVoy (−) 7240H, NVoy (+) 1240H 7240H NVoy (−) NVoy (+)
Rickettsia conorii NP_360910.1, amino acids 1073–1473 0.37 0.91 0.96 1.72 3 2 3 2
Ehrlichia ruminantium YP_196632.1, amino acids 32–297 0.07 0.15 0.07 0.21 2 3 1 1
Rickettsia prowazekii AAF34121.1, amino acids 1–365 0.21 0.39 0.22 0.48 2 2 1 1
Burkholderia pseudomallei ZP_04891863.1, amino acids 267–404 0.11 0.26 0.13 0.60 2 5 1 2
Leishmania infantum XP_001464664.1 0.24 0.47 0.26 ND 2 ND 1 ND
Trypanosoma brucei XP_822456.1 0.27 0.28 0.28 0.61 1 2 1 2

3.3. Solubility testing

One of the more prominent challenges in the WEPRO7240H expression system is the tendency of protein products to form precipitates: some runs of the Protemist XE resulted in a mixture so turbid that the visible-light sensor was unable to function correctly. Likewise, large-scale expression using WEPRO1240H with the Protemist XE resulted in increased protein yields accompanied by a decrease in solubility (data not shown). One of the advantages of the in vitro system is the ability to add reagents as necessary, such as those that help to increase solubility, directly to the translation reaction. One of the factors contributing to protein aggregation is the interaction of exposed hydrophobic patches owing to incorrect protein folding. We therefore chose to investigate the use of NVoy polymer in the cell-free system. Nvoy consists of a carbohydrate backbone with hydrophobic side chains which mask any hydrophobic patches on the protein, thereby limiting nonspecific interactions which can cause aggregation. The effects of the NVoy polymer on solubility and its impact on expression levels were examined in a series of experiments carried out in the Protemist DT II on a subset of five protein targets (Table 2[link]). This subset consisted of targets for which less than 75% of the proteins were soluble when expressed in the DT II or XE; when expressed in E. coli, the protein was predominantly insoluble. WEPRO1240H in the presence and absence of NVoy was tested for five proteins and WEPRO7240H in the presence and absence of NVoy was tested for five proteins, four of which were also used in the WEPRO1240H testing. The NVoy polymer did not decrease the solubility of any of the proteins tested. For two proteins, the expression levels were lower in the presence of NVoy, but this decrease in expression level was accompanied by an increase in solubility (data not shown, Table 3[link]). One protein, which was com­pletely insoluble when expressed with WEPRO7240H, was over 75% soluble when expressed in the same system in the presence of NVoy. Overall, in seven of the 11 paired NVoy(−)/NVoy(+) com­parisons the NVoy reagent increased the percentage soluble protein yield and in half the experiments the reagent more than doubled the yield of soluble protein; for one protein, we were able to obtain more than 1 mg ml−1 soluble protein (Table 3[link]). These tests demonstrate that NVoy does not substantially reduce total protein yields and in most tests increased the quantity and the percentage of soluble protein produced.

4. Discussion

This analysis of expression of proteins from the SSGCID pipeline in a eukaryotic in vitro system validates the use of the wheat germ cell-free system for expression of proteins that are either not expressed or are primarily insoluble when expressed in E. coli. The quantities of soluble protein were sufficient for microcapillary crystallization as developed by Emerald BioSystems (Gerdts et al., 2008[Gerdts, C. J., Elliott, M., Lovell, S., Mixon, M. B., Napuli, A. J., Staker, B. L., Nollert, P. & Stewart, L. (2008). Acta Cryst. D64, 1116-1122.]; Yadav et al., 2005[Yadav, M. K., Gerdts, C. J., Sanishvili, R., Smith, W. W., Roach, L. S., Ismagilov, R. F., Kuhn, P. & Stevens, R. C. (2005). J. Appl. Cryst. 38, 900-905.]), although no crystal structures of any of the protein targets in this set have yet been obtained. Combining the wheat germ cell-free expression system with a crystallization method such as microcapillary crystallization may yield structural data for proteins that have been difficult to express.

A lingering concern is the tendency for insolubility to increase as the quantity of protein produced increases. As a result, for most targets similar quantities of soluble protein were obtained from the use of WEPRO1240H (optimized for the DT II) and WEPRO7240H (optimized for high-level expression in Protemist XE) in the absence of additional solubilizing agents. This may reflect the tendency of the protein to form insoluble aggregates at higher concentrations. The addition of NVoy substantially increased the quantities of soluble protein produced, although even in the presence of NVoy the quantities of soluble protein were insufficient for standard crystallization studies. This demonstrates that NVoy can be added to the translation reaction to increase solubility, potentially eliminating the need to denature and refold the protein for solubility. The addition of other solubilizing reagents may lead to further increases in solubility.

These data demonstrate the utility of the wheat germ cell-free system for expression of proteins that are insoluble when expressed in E. coli. The addition of NVoy substantially increased the yield of soluble protein; this reagent is likely to increase the production of soluble proteins that are insoluble in E. coli.

Acknowledgements

The authors wish to thank all of the members of the SSGCID team and the Cell Free Sciences technical support group. This research was funded under Federal Contract No. HHSN272200700057C from the National Institute of Allergy and Infectious Diseases, the National Institutes of Health, Department of Health and Human Services.

References

First citationDadashipour, M., Fukuta, Y. & Asano, Y. (2011). Protein Expr. Purif. 77, 92–97.  Web of Science CrossRef CAS PubMed Google Scholar
First citationEndo, Y. & Sawasaki, T. (2006). Curr. Opin. Biotechnol. 17, 373–380.  Web of Science CrossRef PubMed CAS Google Scholar
First citationGerdts, C. J., Elliott, M., Lovell, S., Mixon, M. B., Napuli, A. J., Staker, B. L., Nollert, P. & Stewart, L. (2008). Acta Cryst. D64, 1116–1122.  Web of Science CrossRef CAS IUCr Journals Google Scholar
First citationGordon, E., Horsefield, R., Swarts, H. G., de Pont, J. J., Neutze, R. & Snijder, A. (2008). Protein Expr. Purif. 62, 1–8.  Web of Science CrossRef PubMed CAS Google Scholar
First citationGräslund, S. et al. (2008). Nature Methods, 5, 135–146.  Web of Science PubMed Google Scholar
First citationHillebrecht, J. R. & Chong, S. (2008). BMC Biotechnol. 8, 58.  Google Scholar
First citationIdicula-Thomas, S. & Balaji, P. V. (2005). Protein Eng. Des. Sel. 18, 175–180.  PubMed CAS Google Scholar
First citationIdicula-Thomas, S. & Balaji, P. V. (2007). In Silico Biol. 7, 225–237.  PubMed CAS Google Scholar
First citationKawasaki, T., Gouda, M. D., Sawasaki, T., Takai, K. & Endo, Y. (2003). Eur. J. Biochem. 270, 4780–4786.  Web of Science CrossRef PubMed CAS Google Scholar
First citationKlammt, C., Schwarz, D., Löhr, F., Schneider, B., Dötsch, V. & Bernhard, F. (2006). FEBS J. 273, 4141–4153.  Web of Science CrossRef PubMed CAS Google Scholar
First citationKudou, M., Ejima, D., Sato, H., Yumioka, R., Arakawa, T. & Tsumoto, K. (2011). Protein Expr. Purif. 77, 68–74.  Web of Science CrossRef CAS PubMed Google Scholar
First citationLanglais, C., Guilleaume, B., Wermke, N., Scheuermann, T., Ebert, L., LaBaer, J. & Korn, B. (2007). BMC Biotechnol. 7, 64.  Google Scholar
First citationMyler, P. J., Stacy, R., Stewart, L., Staker, B. L., Van Voorhis, W. C., Varani, G. & Buchko, G. W. (2009). Infect. Disord. Drug Targets, 9, 493–506.  CrossRef PubMed CAS Google Scholar
First citationOhana, R. F., Encell, L. P., Zhao, K., Simpson, D., Slater, M. R., Urh, M. & Wood, K. V. (2009). Protein Expr. Purif. 68, 110–120.  Web of Science CrossRef PubMed CAS Google Scholar
First citationSpirin, A. S. (2004). Trends Biotechnol. 22, 538–545.  Web of Science CrossRef PubMed CAS Google Scholar
First citationSun, P., Tropea, J. E. & Waugh, D. S. (2011). Methods Mol. Biol. 705, 259–274.  CrossRef CAS PubMed Google Scholar
First citationTyler, R. C. et al. (2005). Proteins, 59, 633–643.  Web of Science CrossRef PubMed CAS Google Scholar
First citationVinarov, D. A., Loushin Newman, C. L. & Markley, J. L. (2006). FEBS J. 273, 4160–4169.  Web of Science CrossRef PubMed CAS Google Scholar
First citationVinarov, D. A., Loushin Newman, C. L., Tyler, E. M., Markley, J. L. & Shahan, M. N. (2006). Current Protocols in Protein Science, ch. 5, unit 5.18. New York: Wiley.  Google Scholar
First citationWidakowich, G., Zhang, C., Harris, S., Mitri, K., Powers, G., Troung, K.-S. & Hearn, M. T. (2011). Biotechnol. Prog. 27, 1048–1053.  Web of Science CrossRef CAS PubMed Google Scholar
First citationYadav, M. K., Gerdts, C. J., Sanishvili, R., Smith, W. W., Roach, L. S., Ismagilov, R. F., Kuhn, P. & Stevens, R. C. (2005). J. Appl. Cryst. 38, 900–905.  Web of Science CrossRef CAS IUCr Journals Google Scholar
First citationZhang, Y.-B., Howitt, J., McCorkle, S., Lawrence, P., Springer, K. & Freimuth, P. (2004). Protein Expr. Purif. 36, 207–216.  CrossRef PubMed CAS Google Scholar

This is an open-access article distributed under the terms of the Creative Commons Attribution (CC-BY) Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original authors and source are cited.

Journal logoSTRUCTURAL BIOLOGY
COMMUNICATIONS
ISSN: 2053-230X
Volume 67| Part 9| September 2011| Pages 1027-1031
Follow Acta Cryst. F
Sign up for e-alerts
Follow Acta Cryst. on Twitter
Follow us on facebook
Sign up for RSS feeds