crystallization communications\(\def\hfill{\hskip 5em}\def\hfil{\hskip 3em}\def\eqno#1{\hfil {#1}}\)

Journal logoSTRUCTURAL BIOLOGY
COMMUNICATIONS
ISSN: 2053-230X
Volume 68| Part 12| December 2012| Pages 1511-1514

Crystallization of domains involved in self-assembly of the S-layer protein SbsC

aInstitute of Molecular Biosciences, Karl-Franzens University Graz, Humboldtstrasse 50, 8010 Graz, Austria, bDepartment of Nanobiotechnology, University of Natural Resources and Life Sciences, Muthgasse 11, 1190 Vienna, Austria, and cACIB (Austrian Centre of Industrial Biotechnology) GmbH, Petersgasse 14, 8010 Graz, Austria
*Correspondence e-mail: [email protected]

(Received 3 September 2012; accepted 11 October 2012; online 14 November 2012)

The Gram-positive bacterium Geobacillus stearothermophilus ATCC 12980 is completely covered with a two-dimensional crystalline monolayer composed of the S-layer protein SbsC. In order to complete the structure of the full-length protein, additional soluble constructs containing the crucial domains for self-assembly have been successfully cloned, expressed and purified. Crystals obtained from three different recombinant constructs yielded diffraction to 3.4, 2.8 and 1.5 Å resolution. Native data have been collected.

1. Introduction

Crystalline bacterial cell-surface layers, termed S-layers, represent an almost universal feature of archaeal cell envelopes and have been identified in hundreds of different species of bacteria (Sleytr, 1978[Sleytr, U. B. (1978). Int. Rev. Cytol. 53, 1-62.]; Sleytr & Beveridge, 1999[Sleytr, U. B. & Beveridge, T. J. (1999). Trends Microbiol. 7, 253-260.]). They can be regarded as the simplest protein membrane developed during evolution. S-layers, in general, are monomolecular isoporous structures composed of a single protein or glycoprotein species with a molecular mass in the range 40–200 kDa (Sleytr, 1978[Sleytr, U. B. (1978). Int. Rev. Cytol. 53, 1-62.]; Sleytr & Beveridge, 1999[Sleytr, U. B. & Beveridge, T. J. (1999). Trends Microbiol. 7, 253-260.]; Sleytr & Messner, 2009[Sleytr, U. B. & Messner, P. (2009). Encyclopedia of Microbiology, edited by M. Schaechter, pp. 89-98. San Diego: Academic Press/Elsevier Science.]). Electron-microscopic studies revealed that S-layer lattices can exhibit either oblique (p1, p2), square (p4) or hexagonal (p3, p6) symmetry, with a centre-to-centre spacing of the morphological units of approximately 3–35 nm (Pavkov-Keller et al., 2011[Pavkov-Keller, T., Howorka, S. & Keller, W. (2011). Prog. Mol. Biol. Transl. Sci. 103, 73-130.]; Sleytr et al., 1999[Sleytr, U. B., Messner, P., Pum, D. & Sára, M. (1999). Angew. Chem. Int. Ed. Engl. 38, 1035-1054.]).

Despite their ubiquitous appearance and their obvious importance in many prokaryotic organisms, the role of S-layers in nature is not completely clear. However, it is now recognized that S-layer lattices can provide the organism with a selective advantage by fulfilling a broad spectrum of functions (Beveridge, 1994[Beveridge, T. J. (1994). Curr. Opin. Struct. Biol. 4, 204-212.]; Beveridge & Koval, 1993[Beveridge, T. J. & Koval, S. F. (1993). Advances in Bacterial Paracrystalline Surface Layers. New York: Plenum.]; Sára & Egelseer, 1996[Sára, M. & Egelseer, E. M. (1996). Crystalline Bacterial Cell Surface Proteins, edited by U. B. Sleytr, P. Messner, D. Pum & M. Sára, pp. 103-131. Austin: R. G. Landes Co.]; Sleytr et al., 1993[Sleytr, U. B., Messner, P., Pum, D. & Sára, M. (1993). Mol. Microbiol. 10, 911-916.], 1999[Sleytr, U. B., Messner, P., Pum, D. & Sára, M. (1999). Angew. Chem. Int. Ed. Engl. 38, 1035-1054.]; Sleytr & Sára, 1997[Sleytr, U. B. & Sára, M. (1997). Trends Biotechnol. 15, 20-26.]). Owing to their self-assembly ability, S-layers can be exploited as a patterning element for many nanobiotechnological applications (Egelseer et al., 2010[Egelseer, E. M., Ilk, N., Pum, D., Messner, P., Schäffer, C., Schuster, B. & Sleytr, U. B. (2010). The Encyclopedia of Industrial Biotechnology: Bioprocess, Bioseparation and Cell Technology, edited by M. C. Flickinger, pp. 4424-4448. Hoboken: John Wiley & Sons.]; Ilk et al., 2011[Ilk, N., Egelseer, E. M. & Sleytr, U. B. (2011). Curr. Opin. Biotechnol. 22, 824-831.]; Sleytr et al., 2005[Sleytr, U. B., Sára, M., Pum, D. & Schuster, B. (2005). Supramolecular Polymers, edited by A. Ciferri, pp. 583-612. New York: Marcel Dekker.], 2007[Sleytr, U. B., Egelseer, E. M., Ilk, N., Pum, D. & Schuster, B. (2007). FEBS J. 274, 323-334.], 2010[Sleytr, U. B., Egelseer, E. M., Ilk, N., Messner, P., Schäffer, C., Pum, D. & Schuster, B. (2010). Prokaryotic Cell Wall Compounds - Structure and Biochemistry, edited by H. König, H. Claus & A. Varma, pp. 459-481. Heidelberg: Springer.], 2011[Sleytr, U. B., Schuster, B., Egelseer, E. M., Pum, D., Horejs, C. M., Tscheliessnig, R. & Ilk, N. (2011). Prog. Mol. Biol. Transl. Sci. 103, 277-352.]).

The protein precursor of the oblique lattice-forming S-layer protein SbsC from Geobacillus stearothermophilus ATCC 12980 (Egelseer et al., 1996[Egelseer, E. M., Schocher, I., Sleytr, U. B. & Sára, M. (1996). J. Bacteriol. 178, 5602-5609.]) consists of 1099 amino acids including a 30-­amino-acid-long Gram-positive signal peptide (UniProt O68840; Jarosch et al., 2000[Jarosch, M., Egelseer, E. M., Mattanovich, D., Sleytr, U. B. & Sára, M. (2000). Microbiology, 146, 273-281.]). Based on the gene sequence, different N- or C-­terminally truncated S-layer protein constructs have been recombinantly produced and systematically surveyed for their self-assembly and recrystallization properties (Jarosch et al., 2001[Jarosch, M., Egelseer, E. M., Huber, C., Moll, D., Mattanovich, D., Sleytr, U. B. & Sára, M. (2001). Microbiology, 147, 1353-1363.]). These studies confirmed that the N-terminal part comprising amino acids 31–258 is exclusively responsible for cell-wall binding, whereas the larger, C-­terminal part comprises the self-assembly domain responsible for the formation of the crystalline array. This result has been corroborated by surface plasmon resonance (SPR) and isothermal titration calorimetry (ITC) studies showing that the positively charged N-­terminal region of SbsC binds specifically to a negatively charged secondary cell-wall polymer (SCWP; Ferner-Ortner et al., 2007[Ferner-Ortner, J., Mader, C., Ilk, N., Sleytr, U. B. & Egelseer, E. M. (2007). J. Bacteriol. 189, 7154-7158.]; Pavkov et al., 2008[Pavkov, T., Egelseer, E. M., Tesarz, M., Svergun, D. I., Sleytr, U. B. & Keller, W. (2008). Structure, 16, 1226-1237.]).

The property of S-layer proteins to self-assemble into two-dimensional crystals makes them very demanding candidates for structural studies. The crystallization and/or X-ray structures of several bacterial and archaeal truncated and soluble S-layer constructs that have been reported to date are as follows: N-­terminal and C-terminal parts of SbsC from G. stearothermophilus ATTC 12980 (Kroutil et al., 2009[Kroutil, M., Pavkov, T., Birner-Gruenberger, R., Tesarz, M., Sleytr, U. B., Egelseer, E. M. & Keller, W. (2009). Acta Cryst. F65, 1042-1047.]; Pavkov et al., 2003[Pavkov, T., Oberer, M., Egelseer, E. M., Sára, M., Sleytr, U. B. & Keller, W. (2003). Acta Cryst. D59, 1466-1468.], 2008[Pavkov, T., Egelseer, E. M., Tesarz, M., Svergun, D. I., Sleytr, U. B. & Keller, W. (2008). Structure, 16, 1226-1237.]), a truncated derivative of the low-molecular-weight (LMW) S-layer protein from Clostridium difficile (Fagan et al., 2009[Fagan, R. P., Albesa-Jové, D., Qazi, O., Svergun, D. I., Brown, K. A. & Fairweather, N. F. (2009). Mol. Microbiol. 71, 1308-1322.]), the cell-wall-binding domain of the Sap protein from Bacillus anthracis comprised of three S-­layer homology (SLH) motifs (Kern et al., 2011[Kern, J., Wilton, R., Zhang, R., Binkowski, T. A., Joachimiak, A. & Schneewind, O. (2011). J. Biol. Chem. 286, 26042-26049.]) and polypeptide chain constructs from the archaeal surface-layer proteins from Staphylo­thermus marinus (Stetefeld et al., 2000[Stetefeld, J., Jenny, M., Schulthess, T., Landwehr, R., Engel, J. & Kammerer, R. A. (2000). Nature Struct. Biol. 7, 772-776.]), Methanosarcina mazei (Jing et al., 2002[Jing, H., Takagi, J., Liu, J., Lindgren, S., Zhang, R., Joachimiak, A., Wang, J. & Springer, T. A. (2002). Structure, 10, 1453-1464.]) and M. acetivorans (Arbing et al., 2012[Arbing, M. A., Chan, S., Shin, A., Phan, T., Ahn, C. J., Rohlin, L. & Gunsalus, R. P. (2012). Proc. Natl Acad. Sci. USA, 109, 11812-11817.]). Recently, the X-­ray structure of the S-layer protein SbsB from G. stearothermo­philus PV72/p2 lacking the cell-wall-binding domain was reported (Baranova et al., 2012[Baranova, E., Fronzes, R., Garcia-Pino, A., Van Gerven, N., Papapostolou, D., Péhau-Arnaudet, G., Pardon, E., Steyaert, J., Howorka, S. & Remaut, H. (2012). Nature (London), 487, 119-122.]). The protein was crystallized in the presence of a nanobody as a crystallization chaperone preventing the self-assembly of the protein into two-dimensional crystals.

In order to complete the atomic structure of SbsC, we performed crystallization with different soluble truncation forms containing the domains responsible for self-assembly (Fig. 1[link]).

[Figure 1]
Figure 1
Graphical representation of full-length rSbsC with domains indicated. The SCWP binding domain is marked with dots and domains involved in self-assembly are shown in dark grey. Constructs for which diffraction-quality crystals were obtained are coloured black, whereas constructs that did not yield crystals are coloured light grey.

2. Materials and methods

2.1. Cloning, expression and purification

The truncation constructs rSbsC(31–761), rSbsC(31–754), rSbsC(31–790), rSbsC(447–754), rSbsC(443–650) and rSbsC(541–759) were cloned and expressed according to published protocols (Jarosch et al., 2001[Jarosch, M., Egelseer, E. M., Huber, C., Moll, D., Mattanovich, D., Sleytr, U. B. & Sára, M. (2001). Microbiology, 147, 1353-1363.]; Kroutil et al., 2009[Kroutil, M., Pavkov, T., Birner-Gruenberger, R., Tesarz, M., Sleytr, U. B., Egelseer, E. M. & Keller, W. (2009). Acta Cryst. F65, 1042-1047.]). In brief, the gene sequences encoding the truncations were PCR-amplified using the respective oligonucleotide primers (given in Table 1[link]), which introduced the restriction sites NcoI (including an ATG start codon) and XhoI at the 5′ and 3′ ends, respectively. For cloning, the resulting PCR products were ligated with plasmid pET28a+ (Novagen) and the recombinant plasmids were electroporated into Escherichia coli TG1 (Stratagene). For expression, the plasmids were established in E. coli One Shot BL21 Star (Invitrogen). Purification of the recombinant proteins was performed by fractionated ammonium sulfate precipitation and size-exclusion chromatography as described by Pavkov et al. (2003[Pavkov, T., Oberer, M., Egelseer, E. M., Sára, M., Sleytr, U. B. & Keller, W. (2003). Acta Cryst. D59, 1466-1468.]), except that the lyophilization steps between the chromatography runs were omitted. Purified constructs were dialyzed against 50 mM Tris–HCl pH 7.2 and stored at 277 K. The proteins were highly soluble and no degradation was observed within a period of six months.

Table 1
Oligonucleotide primer pairs used for PCR amplification of the gene sequences encoding the various rSbsC truncations

Overhangs are underlined, restriction sites are shown in bold and start and stop codons are shown in italics.

rSbsC truncation Primer names Primer sequence (5′ to 3′)
rSbsC(31–761) rSbsC-31-forw CGGAATTCCATGGCAACGGACGTGGCGAC
rSbsC-761-rev GACCGCTCGAGTTATTTTAATGTAGTATCGATGACTTCAAC
rSbsC(31–754) rSbsC-31-forw CGGAATTCCATGGCAACGGACGTGGCGAC
rSbsC-754-rev GACCGCTCGAGTTATTCAACATCTACAGTACCTAGAG
rSbsC(31–790) rSbsC-31-forw CGGAATTCCATGGCAACGGACGTGGCGAC
rSbsC-790-rev GACCGCTCGAGTTATAAGTTAGCTAGTAACTTAGCTAAAG
rSbsC(447–754) rSbsC-447-forw CGGAATTCCATGGCAGAAGTTAGTGAATTAAAATTAACT
rSbsC-754-rev GACCGCTCGAGTTATTCAACATCTACAGTACCTAGAG
rSbsC(443–650) rSbsC-443-forw CGGAATTCCATGGATGAAAAAGCTGCAGAAGTTAG
rSbsC-650-rev GACCGCTCGAGTTATACTGGTCCGCCAGCAAC
rSbsC(541–759) rSbsC-541-forw CGGAATTCCATGGTTACTAAGACAATCCCTGTGAC
rSbsC-759-rev GACCGCTCGAGTTATGTAGTATCGATGACTTCAACATC

2.2. Crystallization

Initial crystal screening and optimization trials for all constructs were performed with an Oryx8 robot (Douglas Instruments) using commercially available Index (Hampton Research) and Morpheus (Molecular Dimensions Ltd; Gorrec, 2009[Gorrec, F. (2009). J. Appl. Cryst. 42, 1035-1042.]) screens. All screens and optimization setups were performed in Douglas vapour-batch plates (Douglas Instruments), which were covered with 3 ml of an oil mixture consisting of paraffin (Merck) and silicone oil (Sigma–Aldrich) in a 3:1 ratio. Drops of 1 µl were pipetted for both initial screens and optimizations. For initial screening, a 1:1 ratio of protein and commercial screening solutions was used. Optimization experiments included variation of this ratio as well as variation of the concentrations of the different screening-solution components. Crystallization plates were incubated at 293 K, with the exceptions of those for rSbsC(443–650) and rSbsC(541–759), which gave better crystals at 289 K.

Crystallization of rSbsC(31–790) using a protein stock solution at 2.5 mg ml−1 in 50 mM Tris–HCl pH 7.2 gave several crystals of similar morphology (Fig. 2[link]a), all of which yielded the same unit-cell parameters after indexing. The best diffracting crystal appeared after two-and-a-half weeks in optimized Morpheus condition 1-46 [5.2%(w/v) PEG 8000, 10.5%(v/v) ethylene glycol, 0.05 M Bicine/Trizma base pH 8.5 and 0.01 M each of 1,6-hexanediol, 1-­butanol, (RS)-1,2-propanediol, 2-propanol, 1,4-butanediol and 1,3-­propanediol] with a protein end concentration of 0.75 mg ml−1 corresponding to 30% protein solution in the drop.

[Figure 2]
Figure 2
Crystals (upper row) and diffraction images (lower row) of rSbsC(31–790) (a), rSbsC(443–650) (b), rSbsC(541–759) (c) and rSbsC(541–759) in the presence of Ca2+ (d). The size bars represent 0.2 mm.

Crystals of rSbsC(443–650) obtained using a protein stock solution at 5.5 mg ml−1 in 50 mM Tris–HCl pH 7.2 appeared after five-and-a-half weeks under optimized Index condition No. 40 [0.01 M citric acid pH 3.5, 3.0%(w/v) PEG 3350] with an end protein concentration of 2.25 mg ml−1 in the drop (Fig. 2[link]b).

Several conditions yielded crystals of rSbsC(541–759) with octahedral morphology and with varying size and quality (Fig. 2[link]c). The protein concentration of the stock solution was 6.4 mg ml−1 in 50 mM Tris–HCl pH 7.2. Crystals appeared after two-and-a-half weeks in optimized Index condition No. 95 [0.04 M potassium thiocyanate, 12.7%(w/v) PEG MME 2000] with a protein concentration of 3.2 mg ml−1 in the drop. Initial optimization setups were repeated with the same protein solution containing 2 mM CaCl2. Most of these crystals appeared after four weeks. Compared with previous crystals of this truncation form, the new crystals exhibited a different morphology (Fig. 2[link]d). The plate-like crystals showed mostly twinned or smeared spots in one direction. A complete data set was collected from a thicker plate-like crystal showing isotropic diffraction to 1.5 Å resolution. This crystal grew from a condition consisting of 0.05 M potassium thiocyanate, 13.8%(w/v) PEG MME 2000.

2.3. Data collection and processing

Data collection from all crystals was performed at 100 K without additional cryoprotectant, since no ice rings were observed. Data sets from all truncation forms were collected on synchrotron beamlines (EMBL Outstation, Hamburg, Germany and Swiss Light Source, Villigen, Switzerland). Data sets were processed and scaled using the XDS program package (Kabsch, 2010[Kabsch, W. (2010). Acta Cryst. D66, 125-132.]). The unit-cell parameters, assigned space groups and data statistics of the best data set for each truncation form are shown in Table 2[link]. The number of molecules in the asymmetric unit was derived from the self-rotation function calculated with MOLREP (Vagin & Teplyakov, 2010[Vagin, A. & Teplyakov, A. (2010). Acta Cryst. D66, 22-25.]) as well as the approximate solvent content (Table 2[link]).

Table 2
Data-collection and processing statistics

Values in parentheses are for the outer resolution shell.

  rSbsC(31–790) rSbsC(443–650) rSbsC(541–759) rSbsC(541–759) + Ca2+
Beamline PXI [microfocus], SLS PXI [microfocus], SLS PXIII, SLS PXIII, SLS
Wavelength (Å) 1.0 1.0 1.0 1.0
Detector MAR CCD 225 mm MAR CCD 225 mm PILATUS 2M PILATUS 2M
Unit-cell parameters (Å, °) a = 57.2, b = 98.3, c = 109.3, α = γ = 90, β = 94.5 a = b = 110.3, c = 87.2, α = β =γ = 90 a = b = 106.9, c = 110.5, α = β = γ = 90 a = 49.1, b = 43.8, c = 49.7, α = γ = 90, β = 103.8
Space group P21 P41212 P41212 P21
Resolution limits (Å) 19.9–3.4 (3.49–3.40) 30–2.6 (2.70–2.60) 49.1–3.4 (3.61–3.40) 48.3–1.54 (1.64–1.54)
Rmeas (%) 11.6 (46.9) 16.4 (44.2) 4.4 (30.9) 5.0 (35.0)
Rmerge (%) 10.6 (42.9) 15.3 (39.2) 3.9 (27.5) 4.2 (29.0)
Total No. of observations 103011 (7638) 94566 (5440) 78216 (12410) 197022 (28684)
Total No. of unique reflections 16664 (1225) 14641 (1365) 16772 (2665) 58519 (9177)
I/σ(I)〉 14.8 (5.1) 10.8 (3.2) 25.7 (5.8) 15.7 (3.0)
Completeness (%) 99.4 (99.8) 85.5 (77.1) 99.4 (97.7) 98.8 (95.7)
Multiplicity 6.2 (6.2) 6.5 (4.0) 4.7 (4.7) 3.4 (3.1)
Wilson B factor (Å2) 58.6 38.6 96.1 27.2
Matthews coefficient (Å3 Da−1) 3.8 3.1 3.2 2.3
Molecules per asymmetric unit 1 2 2 1
Solvent content (%) 67.5 60.8 61.7 46.6

3. Results and discussion

The structures of two SbsC C-terminal truncation constructs and the successful crystallization of the N-terminally truncated construct rSbsC(755–1099) have been reported previously (Pavkov et al., 2008[Pavkov, T., Egelseer, E. M., Tesarz, M., Svergun, D. I., Sleytr, U. B. & Keller, W. (2008). Structure, 16, 1226-1237.]; Kroutil et al., 2009[Kroutil, M., Pavkov, T., Birner-Gruenberger, R., Tesarz, M., Sleytr, U. B., Egelseer, E. M. & Keller, W. (2009). Acta Cryst. F65, 1042-1047.]). The structure of rSbsC(31–443), containing the first three N-terminal domains, has been determined to 2.4 Å resolution (PDB entry 2ra1 ; Pavkov et al., 2008[Pavkov, T., Egelseer, E. M., Tesarz, M., Svergun, D. I., Sleytr, U. B. & Keller, W. (2008). Structure, 16, 1226-1237.]). The structure of a longer construct rSbsC(31–844) was at a low resolution and was only partially interpretable. Thus, domain-level information could be derived, but large parts of the structure could only be built as a poly-Ala model. Therefore, two new C-terminal truncation forms of similar length, rSbsC(31–761) and rSbsC(31–754), including domains 1–6, were produced. However, these forms yielded no crystals. Owing to the fact that the partial structure of rSbsC(31–844) showed that the observed ring-like structure is stabilized by extra residues from domain 7 (Pavkov et al., 2008[Pavkov, T., Egelseer, E. M., Tesarz, M., Svergun, D. I., Sleytr, U. B. & Keller, W. (2008). Structure, 16, 1226-1237.]), a new longer construct rSbsC(31–790) was produced, for which crystals could be obtained. At the same time, constructs consisting of domains 4–5, 5–6 and 4–6 were subjected to crystallization. Diffraction-quality crystals were obtained for the first two constructs, rSbsC(443–650) and rSbsC(541–759). No crystals were obtained for the construct rSbsC(447–754). It appears that the existence of two flexible linkers between the three domains is detrimental to the formation of an ordered crystal lattice.

A search for structures with significant sequence homology to domains 4, 5 and 6 failed. Therefore, molecular replacement was performed using poly-Ala models of individual domains 4, 5 and 6 from rSbsC(31–844) (Pavkov et al., 2008[Pavkov, T., Egelseer, E. M., Tesarz, M., Svergun, D. I., Sleytr, U. B. & Keller, W. (2008). Structure, 16, 1226-1237.]). For all three truncation constructs, molecular replacement was performed with Phaser (McCoy et al., 2007[McCoy, A. J., Grosse-Kunstleve, R. W., Adams, P. D., Winn, M. D., Storoni, L. C. & Read, R. J. (2007). J. Appl. Cryst. 40, 658-674.]). Manual inspection of the results obtained using Phaser confirmed that rSbsC(31–790) contains one molecule in the asymmetric unit, rSbsC(443–650) contains two molecules in the asymmetric unit and rSbsC(541–759) plus Ca2+ contains one molecule in the asymmetric unit. No clear solution could be obtained using data from rSbsC(541–759) without Ca2+. We believe that the high flexibility of some loop and/or linker regions in the absence of Ca2+ hampers the formation of stable crystal contacts.

Rebuilding and refinement of the structures is in progress and upon completion will yield the complete structure of the full-length SbsC protein.

Acknowledgements

This work was funded by projects J2841, P17885-N11 and P19794-B12 from the Austrian Science Fund (FWF). EME was supported by the US Air Force Office of Scientific Research (AFOSR) project FA9550-10-1-0223. TP-K was supported by the Federal Ministry of Economy, Family and Youth (BMWFJ), the Federal Ministry of Traffic, Innovation and Technology (bmvit), the Styrian Business Promotion Agency SFG, the Standortagentur Tirol and ZIT – Technology Agency of the City of Vienna through the COMET Funding Program managed by the Austrian Research Promotion Agency FFG.

References

First citationArbing, M. A., Chan, S., Shin, A., Phan, T., Ahn, C. J., Rohlin, L. & Gunsalus, R. P. (2012). Proc. Natl Acad. Sci. USA, 109, 11812–11817.  Web of Science CrossRef CAS PubMed Google Scholar
First citationBaranova, E., Fronzes, R., Garcia-Pino, A., Van Gerven, N., Papapostolou, D., Péhau-Arnaudet, G., Pardon, E., Steyaert, J., Howorka, S. & Remaut, H. (2012). Nature (London), 487, 119–122.  Web of Science CAS PubMed Google Scholar
First citationBeveridge, T. J. (1994). Curr. Opin. Struct. Biol. 4, 204–212.  CrossRef CAS Web of Science Google Scholar
First citationBeveridge, T. J. & Koval, S. F. (1993). Advances in Bacterial Paracrystalline Surface Layers. New York: Plenum.  Google Scholar
First citationEgelseer, E. M., Ilk, N., Pum, D., Messner, P., Schäffer, C., Schuster, B. & Sleytr, U. B. (2010). The Encyclopedia of Industrial Biotechnology: Bioprocess, Bioseparation and Cell Technology, edited by M. C. Flickinger, pp. 4424–4448. Hoboken: John Wiley & Sons.  Google Scholar
First citationEgelseer, E. M., Schocher, I., Sleytr, U. B. & Sára, M. (1996). J. Bacteriol. 178, 5602–5609.  CAS PubMed Web of Science Google Scholar
First citationFagan, R. P., Albesa-Jové, D., Qazi, O., Svergun, D. I., Brown, K. A. & Fairweather, N. F. (2009). Mol. Microbiol. 71, 1308–1322.  Web of Science CrossRef PubMed CAS Google Scholar
First citationFerner-Ortner, J., Mader, C., Ilk, N., Sleytr, U. B. & Egelseer, E. M. (2007). J. Bacteriol. 189, 7154–7158.  Web of Science CrossRef PubMed CAS Google Scholar
First citationGorrec, F. (2009). J. Appl. Cryst. 42, 1035–1042.  Web of Science CrossRef CAS IUCr Journals Google Scholar
First citationIlk, N., Egelseer, E. M. & Sleytr, U. B. (2011). Curr. Opin. Biotechnol. 22, 824–831.  Web of Science CrossRef CAS PubMed Google Scholar
First citationJarosch, M., Egelseer, E. M., Huber, C., Moll, D., Mattanovich, D., Sleytr, U. B. & Sára, M. (2001). Microbiology, 147, 1353–1363.  Web of Science PubMed CAS Google Scholar
First citationJarosch, M., Egelseer, E. M., Mattanovich, D., Sleytr, U. B. & Sára, M. (2000). Microbiology, 146, 273–281.  Web of Science PubMed CAS Google Scholar
First citationJing, H., Takagi, J., Liu, J., Lindgren, S., Zhang, R., Joachimiak, A., Wang, J. & Springer, T. A. (2002). Structure, 10, 1453–1464.  Web of Science CrossRef PubMed CAS Google Scholar
First citationKabsch, W. (2010). Acta Cryst. D66, 125–132.  Web of Science CrossRef CAS IUCr Journals Google Scholar
First citationKern, J., Wilton, R., Zhang, R., Binkowski, T. A., Joachimiak, A. & Schneewind, O. (2011). J. Biol. Chem. 286, 26042–26049.  Web of Science CrossRef CAS PubMed Google Scholar
First citationKroutil, M., Pavkov, T., Birner-Gruenberger, R., Tesarz, M., Sleytr, U. B., Egelseer, E. M. & Keller, W. (2009). Acta Cryst. F65, 1042–1047.  Web of Science CrossRef IUCr Journals Google Scholar
First citationMcCoy, A. J., Grosse-Kunstleve, R. W., Adams, P. D., Winn, M. D., Storoni, L. C. & Read, R. J. (2007). J. Appl. Cryst. 40, 658–674.  Web of Science CrossRef CAS IUCr Journals Google Scholar
First citationPavkov, T., Egelseer, E. M., Tesarz, M., Svergun, D. I., Sleytr, U. B. & Keller, W. (2008). Structure, 16, 1226–1237.  Web of Science CrossRef PubMed CAS Google Scholar
First citationPavkov, T., Oberer, M., Egelseer, E. M., Sára, M., Sleytr, U. B. & Keller, W. (2003). Acta Cryst. D59, 1466–1468.  Web of Science CrossRef CAS IUCr Journals Google Scholar
First citationPavkov-Keller, T., Howorka, S. & Keller, W. (2011). Prog. Mol. Biol. Transl. Sci. 103, 73–130.  Web of Science CAS PubMed Google Scholar
First citationSára, M. & Egelseer, E. M. (1996). Crystalline Bacterial Cell Surface Proteins, edited by U. B. Sleytr, P. Messner, D. Pum & M. Sára, pp. 103–131. Austin: R. G. Landes Co.  Google Scholar
First citationSleytr, U. B. (1978). Int. Rev. Cytol. 53, 1–62.  CrossRef CAS PubMed Google Scholar
First citationSleytr, U. B. & Beveridge, T. J. (1999). Trends Microbiol. 7, 253–260.  Web of Science CrossRef PubMed CAS Google Scholar
First citationSleytr, U. B., Egelseer, E. M., Ilk, N., Messner, P., Schäffer, C., Pum, D. & Schuster, B. (2010). Prokaryotic Cell Wall Compounds – Structure and Biochemistry, edited by H. König, H. Claus & A. Varma, pp. 459–481. Heidelberg: Springer.  Google Scholar
First citationSleytr, U. B., Egelseer, E. M., Ilk, N., Pum, D. & Schuster, B. (2007). FEBS J. 274, 323–334.  Web of Science CrossRef PubMed CAS Google Scholar
First citationSleytr, U. B. & Messner, P. (2009). Encyclopedia of Microbiology, edited by M. Schaechter, pp. 89–98. San Diego: Academic Press/Elsevier Science.  Google Scholar
First citationSleytr, U. B., Messner, P., Pum, D. & Sára, M. (1993). Mol. Microbiol. 10, 911–916.  CrossRef CAS PubMed Web of Science Google Scholar
First citationSleytr, U. B., Messner, P., Pum, D. & Sára, M. (1999). Angew. Chem. Int. Ed. Engl. 38, 1035–1054.  CrossRef Google Scholar
First citationSleytr, U. B. & Sára, M. (1997). Trends Biotechnol. 15, 20–26.  CrossRef CAS PubMed Web of Science Google Scholar
First citationSleytr, U. B., Sára, M., Pum, D. & Schuster, B. (2005). Supramolecular Polymers, edited by A. Ciferri, pp. 583–612. New York: Marcel Dekker.  Google Scholar
First citationSleytr, U. B., Schuster, B., Egelseer, E. M., Pum, D., Horejs, C. M., Tscheliessnig, R. & Ilk, N. (2011). Prog. Mol. Biol. Transl. Sci. 103, 277–352.  Web of Science CrossRef CAS PubMed Google Scholar
First citationStetefeld, J., Jenny, M., Schulthess, T., Landwehr, R., Engel, J. & Kammerer, R. A. (2000). Nature Struct. Biol. 7, 772–776.  Web of Science CrossRef PubMed CAS Google Scholar
First citationVagin, A. & Teplyakov, A. (2010). Acta Cryst. D66, 22–25.  Web of Science CrossRef CAS IUCr Journals Google Scholar

This is an open-access article distributed under the terms of the Creative Commons Attribution (CC-BY) Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original authors and source are cited.

Journal logoSTRUCTURAL BIOLOGY
COMMUNICATIONS
ISSN: 2053-230X
Volume 68| Part 12| December 2012| Pages 1511-1514
Follow Acta Cryst. F
Sign up for e-alerts
Follow Acta Cryst. on Twitter
Follow us on facebook
Sign up for RSS feeds