journal menuBuy article online - an online subscription or single-article purchase is required to access this article.
research papers
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Keywords: neutron diffraction; X-ray diffraction; nucleic acids; DNA; acridine derivatives; deuteration; SAXS; SANS.
Subscribe to Acta Crystallographica Section D: Biological Crystallography
