research communications\(\def\hfill{\hskip 5em}\def\hfil{\hskip 3em}\def\eqno#1{\hfil {#1}}\)

Journal logoSTRUCTURAL BIOLOGY
COMMUNICATIONS
ISSN: 2053-230X

The hypothetical periplasmic protein PA1624 from Pseudomonas aeruginosa folds into a unique two-domain structure

CROSSMARK_Color_square_no_text.svg

aMacromolecular Crystallography (HZB-MX), Helmholtz-Zentrum Berlin, Albert-Einstein-Strasse 15, D-12489 Berlin, Germany, bStructure and Function of Proteins, Helmholtz Centre for Infection Research, Inhoffenstrasse 7, D-389124 Braunschweig, Germany, and cInstitute for Biochemistry, Biotechnology and Bioinformatics, Technische Universität Braunschweig, Spielmannstrasse 7, D-38106 Braunschweig, Germany
*Correspondence e-mail: [email protected]

Edited by N. Sträter, University of Leipzig, Germany (Received 1 September 2020; accepted 4 November 2020; online 30 November 2020)

The crystal structure of the 268-residue periplasmic protein PA1624 from the opportunistic pathogen Pseudomonas aeruginosa PAO1 was determined to high resolution using the Se-SAD method for initial phasing. The protein was found to be monomeric and the structure consists of two domains, domains 1 and 2, comprising residues 24–184 and 185–268, respectively. The fold of these domains could not be predicted even using state-of-the-art prediction methods, and similarity searches revealed only a very distant homology to known structures, namely to Mog1p/PsbP-like and OmpA-like proteins for the N- and C-terminal domains, respectively. Since PA1624 is only present in an important human pathogen, its unique structure and periplasmic location render it a potential drug target. Consequently, the results presented here may open new avenues for the discovery and design of antibacterial drugs.

1. Introduction

As of November 2020, the Protein Data Bank (PDB; Berman et al., 2000[Berman, H. M., Westbrook, J., Feng, Z., Gilliland, G., Bhat, T. N., Weissig, H., Shindyalov, I. N. & Bourne, P. E. (2000). Nucleic Acids Res. 28, 235-242.]) contains more than 170 000 structural entries of biological macromolecules, of which more than 90% have been determined by X-ray crystallography. However, most of the newly deposited entries comprise folds that have already been observed in other, homologous structures. This is reflected in the notion that most of the new structures determined by X-ray crystallography are solved by molecular replacement (Long et al., 2008[Long, F., Vagin, A. A., Young, P. & Murshudov, G. N. (2008). Acta Cryst. D64, 125-132.]) and also in the fact that the number of unique protein folds has not significantly increased over the last 15 years (Liu et al., 2004[Liu, X., Fan, K. & Wang, W. (2004). Proteins, 54, 491-499.]). This suggests that the structural universe is much smaller than the sequence universe (Chothia, 1992[Chothia, C. (1992). Nature, 357, 543-544.]; Levitt, 2009[Levitt, M. (2009). Proc. Natl Acad. Sci. USA, 106, 11079-11084.]). Completing the catalog of protein folds invented by nature is a prerequisite for unveiling and comprehending the rules governing protein evolution, understanding the relationship between protein structure and function, and advances in de novo protein design. New folds may not be expected in well characterized genetic landscapes but are more likely to be found within uncharacterized gene products. Therefore, incompletely characterized genomes offer a comparatively higher chance of identifying novel and probably therapeutically interesting protein structures. One of these incompletely understood organisms is the human pathogen Pseudomonas aeruginosa. This Gram-negative bacterium is ubiquitous in nature (Green et al., 1974[Green, S. K., Schroth, M. N., Cho, J. J., Kominos, S. K. & Vitanza-Jack, V. B. (1974). Appl. Microbiol. 28, 987-991.]) and can colonize a variety of different host organisms ranging from insects and animals to plants and mammals (D'Argenio et al., 2001[D'Argenio, D. A., Gallagher, L. A., Berg, C. A. & Manoil, C. (2001). J. Bacteriol. 183, 1466-1471.]; Mahajan-Miklos et al., 1999[Mahajan-Miklos, S., Tan, M.-W., Rahme, L. G. & Ausubel, F. M. (1999). Cell, 96, 47-56.]; Walker et al., 2004[Walker, T. S., Bais, H. P., Déziel, E., Schweizer, H. P., Rahme, L. G., Fall, R. & Vivanco, J. M. (2004). Plant Physiol. 134, 320-331.]). Its versatile metabolism provides a prominent evolutionary advantage, enabling P. aeruginosa to inhabit niches that are harmful or toxic to others (Tsuji et al., 1982[Tsuji, A., Kaneko, Y., Takahashi, K., Ogawa, M. & Goto, S. (1982). Microbiol. Immunol. 26, 15-24.]; Tümmler et al., 2014[Tümmler, B., Wiehlmann, L., Klockgether, J. & Cramer, N. (2014). F1000Prime Rep. 6, 9.]). This makes the bacterium a severe threat to immune-compromised individuals such as AIDS patients or persons suffering from neutropenia and cystic fibrosis (CF) (Aloush et al., 2006[Aloush, V., Navon-Venezia, S., Seigman-Igra, Y., Cabili, S. & Carmeli, Y. (2006). Antimicrob. Agents Chemother. 50, 43-48.]; Hidron et al., 2008[Hidron, A. I., Edwards, J. R., Patel, J., Horan, T. C., Sievert, D. M., Pollock, D. A. & Fridkin, S. K. (2008). Infect. Control Hosp. Epidemiol. 29, 996-1011.]; Hogardt & Heesemann, 2013[Hogardt, M. & Heesemann, J. (2013). Curr. Top. Microbiol. Immunol. 358, 91-118.]) and establishes it as one of the most prevalent nosocomial pathogens worldwide (Bereket et al., 2012[Bereket, W., Hemalatha, K., Getenet, B., Wondwossen, T., Solomon, A., Zeynudin, A. & Kannan, S. (2012). Eur. Rev. Med. Pharmacol. Sci. 16, 1039-1044.]; Santajit & Indrawattana, 2016[Santajit, S. & Indrawattana, N. (2016). Biomed Res. Int. 2016, 2475067.]). In CF, P. aeruginosa evokes chronic lung infections, which is one of the main reasons for lower life expectancy, and is a significant determinant of morbidity and mortality in these patients (Kosorok et al., 2001[Kosorok, M. R., Zeng, L., West, S. E., Rock, M. J., Splaingard, M. L., Laxova, A., Green, C. G., Collins, J. & Farrell, P. M. (2001). Pediatr. Pulmonol. 32, 277-287.]; Li et al., 2005[Li, Z., Kosorok, M. R., Farrell, P. M., Laxova, A., West, S. E. H., Green, C. G., Collins, J., Rock, M. J. & Splaingard, M. L. (2005). JAMA, 293, 581-588.]). During later stages of infection, the bacteria can disseminate via the bloodstream and affect any part of the body, making antimicrobial treatment almost impossible (van Delden, 2007[Delden, C. van (2007). Int. J. Antimicrob. Agents, 30, S71-S75.]; Shorr, 2009[Shorr, A. F. (2009). Crit. Care Med. 37, 1463-1469.]). Therefore, it is not surprising that Pseudomonas has been listed amongst the five top pathogens in modern times (Santajit & Indrawattana, 2016[Santajit, S. & Indrawattana, N. (2016). Biomed Res. Int. 2016, 2475067.]).

P. aeruginosa possesses a large genome that contains more than 5500 open reading frames (ORFs) in the case of the well researched strain P. aeruginosa PAO1. However, even though the genome sequence was completed in 2000 (Stover et al., 2000[Stover, C. K., Pham, X. Q., Erwin, A. L., Mizoguchi, S. D., Warrener, P., Hickey, M. J., Brinkman, F. S., Hufnagle, W. O., Kowalik, D. J., Lagrou, M., Garber, R. L., Goltry, L., Tolentino, E., Westbrock-Wadman, S., Yuan, Y., Brody, L. L., Coulter, S. N., Folger, K. R., Kas, A., Larbig, K., Lim, R., Smith, K., Spencer, D., Wong, G. K., Wu, Z., Paulsen, I. T., Reizer, J., Saier, M. H., Hancock, R. E., Lory, S. & Olson, M. V. (2000). Nature, 406, 959-964.]), and despite the existence of a large community-based annotation effort (Winsor et al., 2016[Winsor, G. L., Griffiths, E. J., Lo, R., Dhillon, B. K., Shay, J. A. & Brinkman, F. S. L. (2016). Nucleic Acids Res. 44, D646-D653.]), there are still more than 2200 genes predicted by bioinformatics, amounting to 35% of all predicted ORFs using DOOR (Mao et al., 2009[Mao, F., Dam, P., Chou, J., Olman, V. & Xu, Y. (2009). Nucleic Acids Res. 37, D459-D463.]), that lack characterization. This uncharted territory is likely to harbor potential drug targets, and it is expected that amongst these uncharacterized genes those that encode proteins with nonpredictable folds will be highly attractive for drug development because it is less probable that they will have an overlapping function with proteins of the host organism.

Here, we describe the X-ray crystallographic structural characterization of one such gene product with unknown function and novel structure, namely the hypothetical protein PA1624 from P. aeruginosa PAO1.

2. Materials and methods

2.1. Macromolecule production

The coding region of PA1624 lacking the first 18 amino acids, representing the periplasmic localization signal, was PCR-amplified from P. aeruginosa PAO1 genomic DNA using the appropriate DNA primer set for cloning into p10$, which generates a rhinovirus 3C protease-cleavable N-terminally tagged His6-T7-lysozyme fusion construct, p10$_Δ18PA1624 (Table 1[link]; Bock et al., 2017[Bock, T., Luxenburger, E., Hoffmann, J., Schütza, V., Feiler, C., Müller, R. & Blankenfeldt, W. (2017). Angew. Chem. Int. Ed. 56, 9986-9989.]). The amino-acid sequence of the entire construct is mghhhhhhaenlyfqghTARVQFKQRESTDAIFVHCSATKPSQNVGVREIRQWHKEQGWLDVGYHFIIKRDGTVEAGRDEMAVGSHAKGYNHNSIGVCLVGGIDDKGKFDANFTPAQMQSLRSLLVTLLAKYEGAVLRAHHEVAPKACPSFDLKRWWEKNELVTSDRGHTlevlfq|gphMADLPGSHDLDILPRFPRAEIVDFRQAPSEERIYPLGAISRISGRLRMEGEVRAEGELTALTYRLPPEHSSQEAFAAARTALLKADATPLFWCERRDCGSSSLLANAVFGNAKLYGPDEQQAYLLVRLAAPQENSLVAVYSITRGNRRAYLQAEELKADAPLAELLPSPATLLRLLKANGELTLSHVPAEPAGSWLELLVRTLRLDTGVRVELSGKHAQEWRDALRGQGVLNSRMELGQSEVEGLHLNWLR, with lower case letters indicating the His6 tag and TEV cleavage site, italic letters indicating the T7-lysozyme moiety and bold letters indicating the Δ18PA1624 part. The symbol | denotes the cleavage site of rhinovirus 3C protease. The plasmid is available upon request.

Table 1
Macromolecule-production information

Source organism P. aeruginosa PAO1
DNA source Genomic DNA
Forward primer† AATATCATATGCGAGGGTTCCTGTTGCTATC
Reverse primer‡ TTATACTCGAGTCAACGCAGCCAGTTGAG
Cloning vector p10$
Expression vector p10$
Expression host E. coli BL21(DE3) and E. coli Rosetta2 pLysS
Complete amino-acid sequence of the construct produced GPHMADLPGSHDLDILPRFPRAEIVDFRQAPSEERIYPLGAISRISGRLRMEGEVRAEGELTALTYRLPPEHSSQEAFAAARTALLKADATPLFWCERRDCGSSSLLANAVFGNAKLYGPDEQQAYLLVRLAAPQENSLVAVYSITRGNRRAYLQAEELKADAPLAELLPSPATLLRLLKANGELTLSHVPAEPAGSWLELLVRTLRLDTGVRVELSGKHAQEWRDALRGQGVLNSRMELGQSEVEGLHLNWLR
UniProt Q9I398_PSEAE
†The NdeI site is in italics.
‡The XhoI site is in italics.

Plasmid-harboring Escherichia coli BL21(DE3) cells were grown in TB medium in a 2 l fermenter at 37°C. When an OD600 of 2.8 was reached, the temperature was lowered to 20°C, 0.5 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) was added and overexpression was carried out for 16 h. The harvested cells were resuspended in buffer A (150 mM NaxHyPO4 pH 8.0, 300 mM NaCl) and lysed. Cell debris and insoluble matter were separated from the soluble fraction before loading onto a precharged nickel HiTrap Chelating HP column equilibrated in buffer A. Nonspecifically bound proteins were removed by washing with 2% buffer B (buffer A with 500 mM imidazole) before a gradient elution to 100% buffer B was performed. 1 mg rhinovirus 3C protease (Cordingley et al., 1990[Cordingley, M. G., Callahan, P. L., Sardana, V. V., Garsky, V. M. & Colonno, R. J. (1990). J. Biol. Chem. 265, 9062-9065.]; Stanway et al., 1984[Stanway, G., Hughes, P. J., Mountford, R. C., Minor, P. D. & Almond, J. W. (1984). Nucleic Acids Res. 12, 7859-7875.]) was added to 40 mg of the fusion protein to remove the His6-T7-lysozyme tag during dialysis (10 kDa cutoff membrane) against buffer GF (50 mM HEPES, 150 mM NaCl pH 8.0) at 4°C overnight. The next day, the protein solution was loaded onto a HiTrap Chelating HP column precharged with nickel to separate noncleaved fusion protein from Δ18PA1624. The concentrated flowthrough (Macrosep Advance, 10 kDa; Pall Corporation) was applied to size-exclusion chromatography using a Superdex 26/600 S75 prep-grade column mounted on an ÄKTA system (GE Healthcare).

Seleno-L-methionine-labeled (SeMet) protein was expressed in E. coli Rosetta2 pLysS cells harboring p10$_Δ18PA1624. Briefly, a preculture was grown in LB medium supplemented with appropriate antibiotics at 37°C overnight and harvested the next day. The cells were resuspended in M9 medium, incubated for 1 h and used as an inoculum for the primary culture in prewarmed M9 medium supplemented with selective antibiotics. The cell cultures were incubated at 37°C and vigorously shaken. When the cell density reached an OD600 of 0.6, an amino-acid mixture inhibiting natural methionine biosynthesis was added (100 mg l−1 lysine, phenylalanine and threonine; 50 mg l−1 isoleucine, leucine and valine) and incubation was continued. The temperature was decreased to 20°C after 10 min and 0.5 mM IPTG and 60 mg l−1 seleno-L-methionine were added. The cultures were shaken for 10 h. Purification steps were performed as described for the native protein. Seleno-L-methionine incorporation was confirmed by MALDI–MS analysis.

2.2. Crystallization

Crystallization screening using both the native and the SeMet variant was carried out in 96-well plates. Standard sitting-drop vapor-diffusion experiments were set up at 20°C employing the commercial screens JCSG Core Suites I–IV (Qiagen). An automated liquid-dispensing robot (Phoenix, Art Robbins Instruments, USA) was employed to mix 0.1 µl concentrated protein solution (12 mg ml−1) with an equal volume of precipitant solution. Initial small plate-shaped crystals were obtained after five days and were refined in a grid screen using a hanging-drop vapor-diffusion setup in 24-well Linbro plates (Table 2[link]). The final mother-liquor composition for the native crystals was 0.2 M sodium acetate, 0.1 M HEPES pH 7.7, 24.5%(w/v) PEG 4000. SeMet protein crystals were obtained using concentrated protein solution (15 mg ml−1) with 0.15 M sodium acetate, 0.1 M HEPES pH 7.1, 23.3%(w/v) PEG 4000. Typical protein crystals grew in thin plates to about 250 × 900 µm within ten days for native and 15 days for SeMet protein (Fig. 1[link]). Harvested crystals were cryoprotected in mother liquor supplemented with 20%(v/v) PEG 400 and then flash-cooled in liquid nitrogen.

Table 2
Crystallization

Protein SeMet Δ18PA1624 Native Δ18PA1624
Method Vapor diffusion, hanging drop Vapor diffusion, hanging drop
Plate type Linbro Linbro
Temperature (K) 293 293
Protein concentration (mg ml−1) 12 15
Buffer composition of protein solution 50 mM HEPES pH 8.0, 150 mM NaCl, 0.25 mM DTT 50 mM HEPES pH 8.0, 150 mM NaCl
Composition of reservoir solution 0.15 M sodium acetate, 0.1 M HEPES pH 7.1, 23.3% PEG 4000 0.2 M sodium acetate, 0.1 M HEPES pH 7.7, 24.5% PEG 4000
Volume and ratio of drop 2 µl, 1:1 ratio 2 µl, 1:1 ratio
Volume of reservoir (µl) 500 500
[Figure 1]
Figure 1
Crystals of native Δ18PA1624 (a) and selenomethionine-derivatized protein (b) could be obtained with slightly different shapes. The native crystals (a) grew as thin fragile plates with sizes of up to 950 × 250 µm. SeMet crystals (b) could be grown to a size of about 450 × 180 µm with a substantial third dimension.

2.3. Data collection and processing

Diffraction data were collected on beamline BL14.1 at the electron-storage ring operated by the Helmholtz-Zentrum Berlin (Mueller et al., 2015[Mueller, U., Förster, R., Hellmig, M., Huschmann, F. U., Kastner, A., Malecki, P., Pühringer, S., Röwer, M., Sparta, K., Steffien, M., Ühlein, M., Wilk, P. & Weiss, M. S. (2015). Eur. Phys. J. Plus, 130, 141.]). Data were collected from native crystals using a CCD detector. Data from the derivatized crystal were collected in eight 360° passes. The crystal was translated between passes. All data were indexed and integrated with XDSAPP (Sparta et al., 2016[Sparta, K. M., Krug, M., Heinemann, U., Mueller, U. & Weiss, M. S. (2016). J. Appl. Cryst. 49, 1085-1092.]) and scaled with AIMLESS (Evans & Murshudov, 2013[Evans, P. R. & Murshudov, G. N. (2013). Acta Cryst. D69, 1204-1214.]). The 〈I/σ(I)〉 value of 2.6 in the outer resolution shell of the SeMet data indicates a non-optimal crystal-to-detector distance during data collection, suggesting that this crystal may have diffracted to an even higher resolution than the reported 1.96 Å. The calculated Matthews coefficient of 2.27 Å3 Da−1 indicated the presence of two monomers in the asymmetric unit.

All relevant data-collection and processing statistics are given in Table 3[link].

Table 3
Data collection and processing

Values in parentheses are for the outer shell.

Protein SeMet Δ18PA1624 Native Δ18PA1624
Diffraction source BL14.1, BESSY II BL14.1, BESSY II
Wavelength (Å) 0.9795 0.91840
Temperature (K) 100 100
Detector Dectris PILATUS 6M Rayonix 225 CCD
Crystal-to-detector distance (mm) 400 250
Rotation range per image (°) 0.1 1
Total rotation range (°) 2880 180
Exposure time per image (s) 0.1 2
Space group P212121 P212121
a, b, c (Å) 53.30, 59.32, 158.54 54.42, 58.81, 163.4
α, β, γ (°) 90, 90, 90 90, 90, 90
Mosaicity (°) 0.16 0.33
Resolution range (Å) 48.0–1.96 (2.03–1.96) 30–2.40 (2.49–2.40)
Total No. of reflections 3344179 (130147) 78498 (8666)
No. of unique reflections 36764 (3576) 21179 (2202)
Completeness (%) 99.4 (98.1) 99.6 (99.8)
Anomalous completeness (%) 99.5 (96.5) —
Multiplicity 91.0 (36.4) 3.7 (3.9)
Anomalous multiplicity 46.5 (12.2) —
〈I/σ(I)〉 27.1 (2.6) 5.1 (1.5)
Rr.i.m. 0.225 (1.76) 0.261 (0.987)
Rp.i.m. 0.023 (0.43) 0.121 (0.414)
Rmerge 0.258 (2.10) 0.223 (852)
CC1/2 0.99 (0.56) 0.98 (0.73)
I/σ(I)asymptotic 24.8 10.1
Overall B factor from Wilson plot (Å2) 21.5 20.5

2.4. Structure solution and refinement

Initial phases were obtained by the single-wavelength anomalous dispersion (SAD) method using the SeMet crystals. Since the protein sequence contains only two selenium-labeled methionine residues (Table 1[link]), highly redundant data were collected. After data reduction and scaling using XDSAPP, structure solution was achieved with SHELX (Sheldrick, 2010[Sheldrick, G. M. (2010). Acta Cryst. D66, 479-485.]). The anomalous signal was extracted using SHELXC, the substructure was determined with SHELXD, and SHELXE was used to carry out the initial model building of a polyalanine chain.

The initial model was manually corrected and adjusted in Coot (Emsley et al., 2010[Emsley, P., Lohkamp, B., Scott, W. G. & Cowtan, K. (2010). Acta Cryst. D66, 486-501.]). Automated refinement was carried out with the Phenix application phenix.refine (Afonine et al., 2012[Afonine, P. V., Grosse-Kunstleve, R. W., Echols, N., Headd, J. J., Moriarty, N. W., Mustyakimov, M., Terwilliger, T. C., Urzhumtsev, A., Zwart, P. H. & Adams, P. D. (2012). Acta Cryst. D68, 352-367.]; Liebschner et al., 2019[Liebschner, D., Afonine, P. V., Baker, M. L., Bunkóczi, G., Chen, V. B., Croll, T. I., Hintze, B., Hung, L.-W., Jain, S., McCoy, A. J., Moriarty, N. W., Oeffner, R. D., Poon, B. K., Prisant, M. G., Read, R. J., Richardson, J. S., Richardson, D. C., Sammito, M. D., Sobolev, O. V., Stockwell, D. H., Terwilliger, T. C., Urzhumtsev, A. G., Videau, L. L., Williams, C. J. & Adams, P. D. (2019). Acta Cryst. D75, 861-877.]). MolProbity (Williams et al., 2018[Williams, C. J., Headd, J. J., Moriarty, N. W., Prisant, M. G., Videau, L. L., Deis, L. N., Verma, V., Keedy, D. A., Hintze, B. J., Chen, V. B., Jain, S., Lewis, S. M., Arendall, W. B., Snoeyink, J., Adams, P. D., Lovell, S. C., Richardson, J. S. & Richardson, D. C. (2018). Protein Sci. 27, 293-315.]) was used for Ramachandran analysis and evaluation of the model quality. The final model was refined to an Rcryst of 17.5% and an Rfree of 23.9% against the higher resolution (1.96 Å) SeMet data set. The collected diffraction data were processed to 1.96 Å resolution. Despite a rather high signal-to-noise ratio of 2.6 in the outermost resolution bin, data beyond this resolution limit are incomplete owing to a non-optimal crystal-to-detector distance during the experiment. The Ramachandran plot shows all residues to be in the allowed region and 97% to be in the favored region. Atomic coordinates and structure factors have been deposited in the PDB with accession code 6td9. All relevant refinement and validation statistics are shown in Table 4[link]. The secondary-structure elements were defined using DSS as included in the Phenix suite and PSIPRED (Buchan & Jones, 2019[Buchan, D. W. A. & Jones, D. T. (2019). Nucleic Acids Res. 47, W402-W407.]).

Table 4
Structure refinement

Values in parentheses are for the outer shell.

Resolution range (Å) 47.49–1.96 (2.01–1.96)
Completeness (%) 99.4
σ Cutoff 0
No. of reflections, working set 36757 (2587)
No. of reflections, test set 1805 (135)
Final Rcryst 0.175 (0.290)
Final Rfree 0.239 (0.345)
Cruickshank DPI 0.156
No. of non-H atoms
 Protein 3823
 Ion 10
 Ligand 29
 Water 338
 Total 4200
R.m.s. deviations
 Bond lengths (Å) 0.011
 Angles (°) 1.24
Average B factors (Å2)
 Protein 29.3
 Ion 56.2
 Ligand 41.8
 Water 33.7
Ramachandran plot
 Favored regions (%) 97.1
 Additionally allowed (%) 2.5
 Outliers (%) 0.2

3. Results and discussion

Here, we present the crystal structure of PA1624, a 268-amino-acid hypothetical protein from the human opportunistic pathogen P. aeruginosa strain PAO1 that is localized in its periplasm (Fig. 2[link]). The protein was heterologously expressed in E. coli without its periplasmatic localization signal (Δ18PA1624). We tested several standard expression plasmids, including, for example, pET-19, pMal and pET-28, but using an N-terminal T7-lysozyme fusion as encoded in our self-designed p10$ plasmid provided the best results with respect to the yield of soluble protein.

[Figure 2]
Figure 2
(a) Overall topology of Δ18PA1624 with α-helical elements colored yellow and β-strands red. The two domains are connected via a long linker stretching from β9 to α3. The light blue connection indicates a disulfide bridge. (b) The amino-acid conservation was calculated with ConSurf (Ashkenazy et al., 2016[Ashkenazy, H., Abadi, S., Martz, E., Chay, O., Mayrose, I., Pupko, T. & Ben-Tal, N. (2016). Nucleic Acids Res. 44, W344-W350.]) and plotted on the protein structure. (c) Ribbon representation of Δ18PA1624. The same coloring scheme as in (a) was used. The circle indicates the location of the hydrophobic cavity shown from different angles in (d). (d) The hydrophobic cavity location and its shape are depicted in three different orientations.

PA1624 does not display any detectable sequence homology to previously determined protein structures. Structure prediction using Phyre2 (Kelley et al., 2015[Kelley, L. A., Mezulis, S., Yates, C. M., Wass, M. N. & Sternberg, M. J. E. (2015). Nat. Protoc. 10, 845-858.]) failed to produce a reliable structure model for molecular replacement. We therefore resorted to phasing by the Se-SAD method, allowing us to determine and refine the structure to 1.96 Å resolution with Rcryst = 17.5% and Rfree = 23.9%. The data collected from the native crystal were not further used for refinement and structure analysis as the diffraction data obtained from the SeMet crystals were of higher quality.

The asymmetric unit of the orthorhombic crystal form studied here contained two chains of Δ18PA1624, which superpose with a Cα r.m.s.d. of 0.5 Å, which is only slightly higher than the coordinate error. PISA analysis (Krissinel & Henrick, 2007[Krissinel, E. & Henrick, K. (2007). J. Mol. Biol. 372, 774-797.]) indicates that the protein is monomeric, which is in line with observations made during the course of purification by size-exclusion chromatography.

Except for a handful of flexible residues at the N-terminus, both chains could be traced with confidence. The Δ18PA1624 monomer has approximate dimensions of 54 × 45 × 48 Å. It folds into two distinguishable domains, comprising residues 24–184 and 185–268, as determined by PiSQRD (Aleksiev et al., 2009[Aleksiev, T., Potestio, R., Pontiggia, F., Cozzini, S. & Micheletti, C. (2009). Bioinformatics, 25, 2743-2744.]). The two domains interact through a relatively small hydrophobic interface covering about 600 Å2. The larger domain is dominated by a six-stranded antiparallel β-sheet that is covered by one α-helix on the face that also harbors the N-terminus and by a mixed α/β structure on the other. The smaller domain features a four-stranded mixed β-sheet lined by four α-helices on the face contacting the N-terminal domain (Fig. 2[link]a). A disulfide bridge between cysteine residues 110 and 115 provides rigidity to the structures (Fig. 2[link]c).

The presence of two domains in PA1624 was not anticipated, since an automated Pfam sequence analysis (Finn et al., 2010[Finn, R. D., Mistry, J., Tate, J., Coggill, P., Heger, A., Pollington, J. E., Gavin, O. L., Gunasekaran, P., Ceric, G., Forslund, K., Holm, L., Sonnhammer, E. L. L., Eddy, S. R. & Bateman, A. (2010). Nucleic Acids Res. 38, D211-D222.]) had predicted only one domain, namely a DUF4892 domain extending from positions 20 to 202. Consequently, the question arose whether the two observed domains may be related to other, already known structural building blocks or whether they indeed represent new folds. Despite no apparent sequence similarity or large conserved protein regions that could be identified (Fig. 2[link]b), we found that PA1624 is composed of two previously identified domains. For the N-terminal domain, analysis with DALI (Holm & Laakso, 2016[Holm, L. & Laakso, L. M. (2016). Nucleic Acids Res. 44, W351-W355.]) reveals distant yet significant structural homology to the DUF1795-containing lipoprotein DcrB from Salmonella enterica (Z-score 8.5; PDB entry 6e8a; Rasmussen et al., 2018[Rasmussen, D. M., Soens, R. W., Davie, T. J., Vaneerd, C. K., Bhattacharyya, B. & May, J. F. (2018). J. Struct. Biol. 204, 513-518.]). The proteins align with a Cα r.m.s.d. of 3.2 Å over 101 residues with only 7% sequence identity, and differences are mainly owing to a β-structure insertion between β-strands 1 and 2 and additional α-helical structure between β-strands 3 and 4 in PA1624 (Fig. 3[link]a). The closest homolog of the C-terminal domain is a building block of Tp0624 from Treponema pallidum (Z-score 8.3; PDB entry 5jir; Parker et al., 2016[Parker, M. L., Houston, S., Wetherell, C., Cameron, C. E. & Boulanger, M. J. (2016). PLoS One, 11, e0166274.]), which aligns with a Cα r.m.s.d. of 2.8 Å over 78 residues, displaying a sequence identity of 15% (Figs. 3[link]b and 3[link]c). The Tp0624 domain appears to be larger owing to an additional α-helix inserted between the β-strands corresponding to the third and fourth β-strand of the domain in PA1624, as well as a significantly longer α-helix following the second β-strand. Further, the first secondary-structure element of this domain in PA1624 is an α-helix, whereas Tp0624 possesses a β-strand in this position (Fig. 3[link]b, lower panel).

[Figure 3]
Figure 3
Superposition of the C- and N-terminal domains of Δ18PA1624 with structurally related proteins. Δ18PA1624 is color-coded according to its secondary-structure elements. (a) The N-terminal domain superposes on the full-length lipoprotein DcrB from S. enterica, colored light blue (PDB entry 6ea8), with a Cα r.m.s.d. of 3.2 Å over 101 amino acids. (b) The smaller C-terminal domain structurally aligned with the blue-colored domain of Tp0624 from Treponema pallidum with a Cα r.m.s.d. of 2.8 Å over 78 residues (PDB entry 5jir). (c) Superposition of the C-terminal domain of PA1624 with full-length Tp0624 from T. pallidum.

It is interesting to speculate about the implications for the function of PA1624 that these similarities may suggest. The previous analysis indicated that the DcrB protein is a membrane-anchored periplasmatic protein that belongs to the Mog1p/PsbP family (Rasmussen et al., 2018[Rasmussen, D. M., Soens, R. W., Davie, T. J., Vaneerd, C. K., Bhattacharyya, B. & May, J. F. (2018). J. Struct. Biol. 204, 513-518.]), a group of proteins that perform diverse functions but may be associated with membrane-anchored complexes in bacteria. The identified domain of Tp0624, on the other hand, possesses strong similarities to the OmpA family, a class of proteins involved in proteoglycan binding. In comparison, this hints at a membrane-associated function within the periplasm of P. aeruginosa for PA1624, in line with the anticipated and the experimentally confirmed location of the protein (Imperi et al., 2009[Imperi, F., Ciccosanti, F., Perdomo, A. B., Tiburzi, F., Mancone, C., Alonzi, T., Ascenzi, P., Piacentini, M., Visca, P. & Fimia, G. M. (2009). Proteomics, 9, 1901-1915.]). However, there are also indications that contradict such direct conclusions. Firstly, the N-terminal domain of PA1624 does not contain a cysteine at its N-terminus, as is implicated in lipid modification and membrane anchoring in DcrB. Secondly, the C-terminal OmpA-like domain lacks the conserved sequence motifs that are required for protein glycan binding in these proteins. These motifs reside in the missing secondary-structure elements mentioned above. Therefore, additional studies will be necessary to identify the function of PA1624. Towards this, it is interesting to note that the interior of the C-terminal domain of the protein is not optimally packed, leaving a cavity lined by hydrophobic residues unoccupied. This cavity may sequester a hydrophobic ligand, such as a lipidic component of the membrane (Fig. 2[link]d).

Overall, the structure of PA1624 described here confirms that the vast amount of available structural data makes it challenging to discover new protein folds, even if relationships are not apparent at the sequence level. This seems particularly true for smaller building blocks such as the two unanticipated domains found here in PA1624, since these domains will be dominated by secondary-structure elements that can only fold into a limited number of arrangements. Consequently, domains with no common ancestry will display similar structures, requiring further structure determination to reveal these relationships and inform structure-prediction programs. Therefore, we suggest that PA1624 has a novel, yet-to-be-named architectural domain arrangement.

Supporting information


Acknowledgements

Diffraction data were collected on BL14.1 at the BESSY II electron-storage ring operated by the Helmholtz-Zentrum Berlin (Mueller et al., 2015). We would particularly like to acknowledge the help and support of Dr Karine Roewer during the experiment. This work was supported by the Helmholtz Protein Sample Production Facility (HZI PSPF-Platform). The authors declare no conflicts of interest. Open access funding enabled and organized by Projekt DEAL.

References

First citationAfonine, P. V., Grosse-Kunstleve, R. W., Echols, N., Headd, J. J., Moriarty, N. W., Mustyakimov, M., Terwilliger, T. C., Urzhumtsev, A., Zwart, P. H. & Adams, P. D. (2012). Acta Cryst. D68, 352–367.  Web of Science CrossRef CAS IUCr Journals Google Scholar
First citationAleksiev, T., Potestio, R., Pontiggia, F., Cozzini, S. & Micheletti, C. (2009). Bioinformatics, 25, 2743–2744.  CrossRef PubMed CAS Google Scholar
First citationAloush, V., Navon-Venezia, S., Seigman-Igra, Y., Cabili, S. & Carmeli, Y. (2006). Antimicrob. Agents Chemother. 50, 43–48.  CrossRef PubMed CAS Google Scholar
First citationAshkenazy, H., Abadi, S., Martz, E., Chay, O., Mayrose, I., Pupko, T. & Ben-Tal, N. (2016). Nucleic Acids Res. 44, W344–W350.  Web of Science CrossRef CAS PubMed Google Scholar
First citationBereket, W., Hemalatha, K., Getenet, B., Wondwossen, T., Solomon, A., Zeynudin, A. & Kannan, S. (2012). Eur. Rev. Med. Pharmacol. Sci. 16, 1039–1044.  CAS PubMed Google Scholar
First citationBerman, H. M., Westbrook, J., Feng, Z., Gilliland, G., Bhat, T. N., Weissig, H., Shindyalov, I. N. & Bourne, P. E. (2000). Nucleic Acids Res. 28, 235–242.  Web of Science CrossRef PubMed CAS Google Scholar
First citationBock, T., Luxenburger, E., Hoffmann, J., Schütza, V., Feiler, C., Müller, R. & Blankenfeldt, W. (2017). Angew. Chem. Int. Ed. 56, 9986–9989.  CrossRef CAS Google Scholar
First citationBuchan, D. W. A. & Jones, D. T. (2019). Nucleic Acids Res. 47, W402–W407.  Web of Science CrossRef CAS PubMed Google Scholar
First citationChothia, C. (1992). Nature, 357, 543–544.  CrossRef PubMed CAS Web of Science Google Scholar
First citationCordingley, M. G., Callahan, P. L., Sardana, V. V., Garsky, V. M. & Colonno, R. J. (1990). J. Biol. Chem. 265, 9062–9065.  CAS PubMed Google Scholar
First citationD'Argenio, D. A., Gallagher, L. A., Berg, C. A. & Manoil, C. (2001). J. Bacteriol. 183, 1466–1471.  PubMed CAS Google Scholar
First citationDelden, C. van (2007). Int. J. Antimicrob. Agents, 30, S71–S75.  PubMed Google Scholar
First citationEmsley, P., Lohkamp, B., Scott, W. G. & Cowtan, K. (2010). Acta Cryst. D66, 486–501.  Web of Science CrossRef CAS IUCr Journals Google Scholar
First citationEvans, P. R. & Murshudov, G. N. (2013). Acta Cryst. D69, 1204–1214.  Web of Science CrossRef CAS IUCr Journals Google Scholar
First citationFinn, R. D., Mistry, J., Tate, J., Coggill, P., Heger, A., Pollington, J. E., Gavin, O. L., Gunasekaran, P., Ceric, G., Forslund, K., Holm, L., Sonnhammer, E. L. L., Eddy, S. R. & Bateman, A. (2010). Nucleic Acids Res. 38, D211–D222.  Web of Science CrossRef PubMed CAS Google Scholar
First citationGreen, S. K., Schroth, M. N., Cho, J. J., Kominos, S. K. & Vitanza-Jack, V. B. (1974). Appl. Microbiol. 28, 987–991.  CrossRef CAS PubMed Google Scholar
First citationHidron, A. I., Edwards, J. R., Patel, J., Horan, T. C., Sievert, D. M., Pollock, D. A. & Fridkin, S. K. (2008). Infect. Control Hosp. Epidemiol. 29, 996–1011.  Web of Science CrossRef PubMed Google Scholar
First citationHogardt, M. & Heesemann, J. (2013). Curr. Top. Microbiol. Immunol. 358, 91–118.  CAS PubMed Google Scholar
First citationHolm, L. & Laakso, L. M. (2016). Nucleic Acids Res. 44, W351–W355.  Web of Science CrossRef CAS PubMed Google Scholar
First citationImperi, F., Ciccosanti, F., Perdomo, A. B., Tiburzi, F., Mancone, C., Alonzi, T., Ascenzi, P., Piacentini, M., Visca, P. & Fimia, G. M. (2009). Proteomics, 9, 1901–1915.  CrossRef PubMed CAS Google Scholar
First citationKelley, L. A., Mezulis, S., Yates, C. M., Wass, M. N. & Sternberg, M. J. E. (2015). Nat. Protoc. 10, 845–858.  Web of Science CrossRef CAS PubMed Google Scholar
First citationKosorok, M. R., Zeng, L., West, S. E., Rock, M. J., Splaingard, M. L., Laxova, A., Green, C. G., Collins, J. & Farrell, P. M. (2001). Pediatr. Pulmonol. 32, 277–287.  CrossRef PubMed CAS Google Scholar
First citationKrissinel, E. & Henrick, K. (2007). J. Mol. Biol. 372, 774–797.  Web of Science CrossRef PubMed CAS Google Scholar
First citationLevitt, M. (2009). Proc. Natl Acad. Sci. USA, 106, 11079–11084.  Web of Science CrossRef PubMed CAS Google Scholar
First citationLi, Z., Kosorok, M. R., Farrell, P. M., Laxova, A., West, S. E. H., Green, C. G., Collins, J., Rock, M. J. & Splaingard, M. L. (2005). JAMA, 293, 581–588.  CrossRef PubMed CAS Google Scholar
First citationLiebschner, D., Afonine, P. V., Baker, M. L., Bunkóczi, G., Chen, V. B., Croll, T. I., Hintze, B., Hung, L.-W., Jain, S., McCoy, A. J., Moriarty, N. W., Oeffner, R. D., Poon, B. K., Prisant, M. G., Read, R. J., Richardson, J. S., Richardson, D. C., Sammito, M. D., Sobolev, O. V., Stockwell, D. H., Terwilliger, T. C., Urzhumtsev, A. G., Videau, L. L., Williams, C. J. & Adams, P. D. (2019). Acta Cryst. D75, 861–877.  Web of Science CrossRef IUCr Journals Google Scholar
First citationLiu, X., Fan, K. & Wang, W. (2004). Proteins, 54, 491–499.  Web of Science CrossRef PubMed CAS Google Scholar
First citationLong, F., Vagin, A. A., Young, P. & Murshudov, G. N. (2008). Acta Cryst. D64, 125–132.  Web of Science CrossRef CAS IUCr Journals Google Scholar
First citationMahajan-Miklos, S., Tan, M.-W., Rahme, L. G. & Ausubel, F. M. (1999). Cell, 96, 47–56.  Web of Science CAS PubMed Google Scholar
First citationMao, F., Dam, P., Chou, J., Olman, V. & Xu, Y. (2009). Nucleic Acids Res. 37, D459–D463.  CrossRef PubMed CAS Google Scholar
First citationMueller, U., Förster, R., Hellmig, M., Huschmann, F. U., Kastner, A., Malecki, P., Pühringer, S., Röwer, M., Sparta, K., Steffien, M., Ühlein, M., Wilk, P. & Weiss, M. S. (2015). Eur. Phys. J. Plus, 130, 141.  Web of Science CrossRef Google Scholar
First citationParker, M. L., Houston, S., Wetherell, C., Cameron, C. E. & Boulanger, M. J. (2016). PLoS One, 11, e0166274.  Web of Science CrossRef PubMed Google Scholar
First citationRasmussen, D. M., Soens, R. W., Davie, T. J., Vaneerd, C. K., Bhattacharyya, B. & May, J. F. (2018). J. Struct. Biol. 204, 513–518.  CrossRef CAS PubMed Google Scholar
First citationSantajit, S. & Indrawattana, N. (2016). Biomed Res. Int. 2016, 2475067.  CrossRef PubMed Google Scholar
First citationSheldrick, G. M. (2010). Acta Cryst. D66, 479–485.  Web of Science CrossRef CAS IUCr Journals Google Scholar
First citationShorr, A. F. (2009). Crit. Care Med. 37, 1463–1469.  CrossRef PubMed Google Scholar
First citationSparta, K. M., Krug, M., Heinemann, U., Mueller, U. & Weiss, M. S. (2016). J. Appl. Cryst. 49, 1085–1092.  Web of Science CrossRef CAS IUCr Journals Google Scholar
First citationStanway, G., Hughes, P. J., Mountford, R. C., Minor, P. D. & Almond, J. W. (1984). Nucleic Acids Res. 12, 7859–7875.  CrossRef CAS PubMed Google Scholar
First citationStover, C. K., Pham, X. Q., Erwin, A. L., Mizoguchi, S. D., Warrener, P., Hickey, M. J., Brinkman, F. S., Hufnagle, W. O., Kowalik, D. J., Lagrou, M., Garber, R. L., Goltry, L., Tolentino, E., Westbrock-Wadman, S., Yuan, Y., Brody, L. L., Coulter, S. N., Folger, K. R., Kas, A., Larbig, K., Lim, R., Smith, K., Spencer, D., Wong, G. K., Wu, Z., Paulsen, I. T., Reizer, J., Saier, M. H., Hancock, R. E., Lory, S. & Olson, M. V. (2000). Nature, 406, 959–964.  CrossRef PubMed CAS Google Scholar
First citationTsuji, A., Kaneko, Y., Takahashi, K., Ogawa, M. & Goto, S. (1982). Microbiol. Immunol. 26, 15–24.  CrossRef CAS PubMed Google Scholar
First citationTümmler, B., Wiehlmann, L., Klockgether, J. & Cramer, N. (2014). F1000Prime Rep. 6, 9.  Google Scholar
First citationWalker, T. S., Bais, H. P., Déziel, E., Schweizer, H. P., Rahme, L. G., Fall, R. & Vivanco, J. M. (2004). Plant Physiol. 134, 320–331.  CrossRef PubMed CAS Google Scholar
First citationWilliams, C. J., Headd, J. J., Moriarty, N. W., Prisant, M. G., Videau, L. L., Deis, L. N., Verma, V., Keedy, D. A., Hintze, B. J., Chen, V. B., Jain, S., Lewis, S. M., Arendall, W. B., Snoeyink, J., Adams, P. D., Lovell, S. C., Richardson, J. S. & Richardson, D. C. (2018). Protein Sci. 27, 293–315.  Web of Science CrossRef CAS PubMed Google Scholar
First citationWinsor, G. L., Griffiths, E. J., Lo, R., Dhillon, B. K., Shay, J. A. & Brinkman, F. S. L. (2016). Nucleic Acids Res. 44, D646–D653.  CrossRef CAS PubMed Google Scholar

This is an open-access article distributed under the terms of the Creative Commons Attribution (CC-BY) Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original authors and source are cited.

Journal logoSTRUCTURAL BIOLOGY
COMMUNICATIONS
ISSN: 2053-230X
Follow Acta Cryst. F
Sign up for e-alerts
Follow Acta Cryst. on Twitter
Follow us on facebook
Sign up for RSS feeds