research communications\(\def\hfill{\hskip 5em}\def\hfil{\hskip 3em}\def\eqno#1{\hfil {#1}}\)

Journal logoSTRUCTURAL BIOLOGY
COMMUNICATIONS
ISSN: 2053-230X

Pseudomonas aeruginosa esterase PA2949, a bacterial homolog of the human membrane esterase ABHD6: expression, purification and crystallization

CROSSMARK_Color_square_no_text.svg

aInstitute of Molecular Enzyme Technology, Heinrich-Heine-Universität Düsseldorf, Forschungszentrum Jülich GmbH, D-52426 Jülich, Germany, bInstitute of Complex Systems ICS-6: Structural Biochemistry, Forschungszentrum Jülich GmbH, D-52425 Jülich, Germany, cInstitute of Pharmaceutical and Medicinal Chemistry, Heinrich-Heine-Universität Düsseldorf, D-40225 Düsseldorf, Germany, dJohn von Neumann Institute for Computing (NIC) and Jülich Supercomputing Centre (JSC), Forschungszentrum Jülich GmbH, D-52425 Jülich, Germany, and eInstitute of Bio- and Geosciences IBG-1: Biotechnology, Forschungszentrum Jülich GmbH, D-52426 Jülich, Germany
*Correspondence e-mail: [email protected], [email protected], [email protected]

Edited by A. K. Mitra, University of Auckland, New Zealand (Received 30 October 2018; accepted 10 February 2019; online 2 April 2019)

The human membrane-bound α/β-hydrolase domain 6 (ABHD6) protein modulates endocannabinoid signaling, which controls appetite, pain and learning, as well as being linked to Alzheimer's and Parkinson's diseases, through the degradation of the key lipid messenger 2-arachidonylglycerol (2-AG). This makes ABHD6 an attractive therapeutic target that lacks structural information. In order to better understand the molecular mechanism of 2-AG-hydrolyzing enzymes, the PA2949 protein from Pseudomonas aeruginosa, which has 49% sequence similarity to the ABHD6 protein, was cloned, overexpressed, purified and crystallized. Overexpression of PA2949 in the homologous host yielded the membrane-bound enzyme, which was purified in milligram amounts. Besides their sequence similarity, the enzymes both show specificity for the hydrolysis of 2-AG and esters of medium-length fatty acids. PA2949 in the presence of n-octyl β-D-glucoside showed a higher activity and stability at room temperature than those previously reported for PA2949 overexpressed and purified from Escherichia coli. A suitable expression host and stabilizing detergent were crucial for obtaining crystals, which belonged to the tetragonal space group I4122 and diffracted to a resolution of 2.54 Å. This study provides hints on the functional similarity of ABHD6-like proteins in prokaryotes and eukaryotes, and might guide the structural study of these difficult-to-crystallize proteins.

1. Introduction

Enzymes of the α/β-hydrolase superfamily are found in virtually all organisms and have functional implications that are important to human health (Lord et al., 2013[Lord, C. C., Thomas, G. & Brown, J. M. (2013). Biochim. Biophys. Acta, 1831, 792-802.]) and bacterial pathogenesis (Flores-Díaz et al., 2016[Flores-Díaz, M., Monturiol-Gross, L., Naylor, C., Alape-Girón, A. & Flieger, A. (2016). Microbiol. Mol. Biol. Rev. 80, 597-628.]). The canonical α/β-hydrolase fold consists of up to 11 β-strands folded into a central hydrophobic sheet surrounded by flanking α-helices (Heikinheimo et al., 1999[Heikinheimo, P., Goldman, A., Jeffries, C. & Ollis, D. L. (1999). Structure, 7, R141-R146.]). This fold provides a scaffold for a structurally conserved active site comprising the catalytic triad (Ser, His, Asp) and two oxyanion-hole residues (Heikinheimo et al., 1999[Heikinheimo, P., Goldman, A., Jeffries, C. & Ollis, D. L. (1999). Structure, 7, R141-R146.]). The hydrolytic reactions that are catalyzed by α/β-hydrolases rely on a hydrogen-bond network between the catalytic triad residues that is essential for formation of the nucleophilic serine (Rauwerdink & Kazlauskas, 2015[Rauwerdink, A. & Kazlauskas, R. J. (2015). ACS Catal. 5, 6153-6176.]). The residues of the oxyanion hole stabilize the tetrahedral intermediates (Pérez et al., 2012[Pérez, D., Kovacic, F., Wilhelm, S., Jaeger, K. E., García, M. T., Ventosa, A. & Mellado, E. (2012). Microbiology, 158, 2192-2203.]; Rauwerdink & Kazlauskas, 2015[Rauwerdink, A. & Kazlauskas, R. J. (2015). ACS Catal. 5, 6153-6176.]).

Mammals express at least 19 α/β-hydrolases [called α/β-hydrolase domain (ABHD) proteins in the literature], and the biochemical and physiological functions of most of them are largely unknown (Lord et al., 2013[Lord, C. C., Thomas, G. & Brown, J. M. (2013). Biochim. Biophys. Acta, 1831, 792-802.]). Functional proteomics of brain tissue revealed ABHD6 to be a 2-arachidonylglycerol (2-AG) hydrolase (Blankman et al., 2007[Blankman, J. L., Simon, G. M. & Cravatt, B. F. (2007). Chem. Biol. 14, 1347-1356.]). 2-AG is biosynthesized from membrane phospholipid precursors and stimulates cannabinoid (CB) receptors in the vicinity of its own synthesis. A recent study confirmed that ABHD6 controls the levels and signaling efficacy of 2-AG in neurons and is thus considered to be a member of the endocannabinoid signaling pathway (Marrs et al., 2010[Marrs, W. R., Blankman, J. L., Horne, E. A., Thomazeau, A., Lin, Y. H., Coy, J., Bodor, A. L., Muccioli, G. G., Hu, S. S.-J., Woodruff, G., Fung, S., Lafourcade, M., Alexander, J. P., Long, J. Z., Li, W., Xu, C., Möller, T., Mackie, K., Manzoni, O. J., Cravatt, B. F. & Stella, N. (2010). Nat. Neurosci. 13, 951-957.]). This system controls diverse physiological processes such as pain sensation, the maintenance of food intake, learning and memory, and is related to Alzheimer's and Parkinson's diseases (Fernández-Ruiz et al., 2015[Fernández-Ruiz, J., Romero, J. & Ramos, J. A. (2015). Handb. Exp. Pharmacol. 231, 233-259.]). Furthermore, ABHD6 is differentially expressed in seven tumor cell lines, with particularly high expression being observed in Ewing family tumors (Lord et al., 2013[Lord, C. C., Thomas, G. & Brown, J. M. (2013). Biochim. Biophys. Acta, 1831, 792-802.]). Therefore, ABHD6 has been suggested as a new diagnostic marker for these tumors (Max et al., 2009[Max, D., Hesse, M., Volkmer, I. & Staege, M. S. (2009). Cancer Sci. 100, 2383-2389.]; Lord et al., 2013[Lord, C. C., Thomas, G. & Brown, J. M. (2013). Biochim. Biophys. Acta, 1831, 792-802.]). Moreover, ABHD6-knockout mice showed reduced body weight, improved glucose homeostasis and insulin action that prevents obesity and type 2 diabetes (Zhao et al., 2016[Zhao, S., Mugabo, Y., Ballentine, G., Attane, C., Iglesias, J., Poursharifi, P., Zhang, D., Nguyen, T. A., Erb, H., Prentki, R., Peyot, M.-L., Joly, E., Tobin, S., Fulton, S., Brown, J. M., Madiraju, S. R. M. & Prentki, M. (2016). Cell Rep. 14, 2872-2888.]). ABHD6 has emerged as a promising pharmaceutical target, the inhibition of which has been studied biochemically and in silico (Feledziak et al., 2012[Feledziak, M., Lambert, D. M., Marchand-Brynaert, J. & Muccioli, G. G. (2012). Recent Pat. CNS Drug. Discov. 7, 49-70.]; Bowman & Makriyannis, 2013[Bowman, A. L. & Makriyannis, A. (2013). Chem. Biol. Drug Des. 81, 382-388.]). However, the three-dimensional structure of ABHD6 remains elusive.

We recently characterized the α/β-hydrolase PA2949 from P. aeruginosa (Kovacic, Bleffert et al., 2016[Kovacic, F., Bleffert, F., Caliskan, M., Wilhelm, S., Granzin, J., Batra-Safferling, R. & Jaeger, K. E. (2016). FEBS Open Bio, 6, 484-493.]). P. aeruginosa is a versatile pathogen that causes infections in mammals, plants and insects (Mahajan-Miklos et al., 2000[Mahajan-Miklos, S., Rahme, L. G. & Ausubel, F. M. (2000). Mol. Microbiol. 37, 981-988.]). It mainly infects immunocompromised patients, in particular cystic fibrosis, AIDS and cancer patients (Folkesson et al., 2012[Folkesson, A., Jelsbak, L., Yang, L., Johansen, H. K., Ciofu, O., Høiby, N. & Molin, S. (2012). Nat. Rev. Microbiol. 10, 841-851.]). The pathogenicity of P. aeruginosa is predominantly related to the production of a large spectrum of cell-associated and cell-secreted virulence factors, among which are several α/β-hydrolases (Van Delden & Iglewski, 1998[Van Delden, C. & Iglewski, B. H. (1998). Emerg. Infect. Dis. 4, 551-560.]; Bofill et al., 2010[Bofill, C., Prim, N., Mormeneo, M., Manresa, A., Javier Pastor, F. I. & Diaz, P. (2010). Biochimie, 92, 307-316.]). PA2949 is a 34.8 kDa protein that shows esterase activity and is anchored to the E. coli membrane by a putative N-terminal transmembrane domain (Kovacic, Bleffert et al., 2016[Kovacic, F., Bleffert, F., Caliskan, M., Wilhelm, S., Granzin, J., Batra-Safferling, R. & Jaeger, K. E. (2016). FEBS Open Bio, 6, 484-493.]). PA2949 contains a typical α/β-hydrolase Ser–His–Asp catalytic triad, as shown previously in our mutagenesis studies (Kovacic, Bleffert et al., 2016[Kovacic, F., Bleffert, F., Caliskan, M., Wilhelm, S., Granzin, J., Batra-Safferling, R. & Jaeger, K. E. (2016). FEBS Open Bio, 6, 484-493.]).

Here, we report the expression in the homologous host P. aeruginosa, purification from membranes, crystallization and preliminary X-ray analysis of PA2949, a bacterial homolog of human ABHD6. To date, no structure is available of a protein containing an ABHD6-like domain. Therefore, the structure of the putatively single-pass integral membrane protein PA2949 should contribute to the understanding of the function of these proteins, with potential therapeutic implications.

2. Materials and methods

2.1. Overexpression and purification

P. aeruginosa PA01 cells harboring pBBR-pa2949 (Kovacic, Bleffert et al., 2016[Kovacic, F., Bleffert, F., Caliskan, M., Wilhelm, S., Granzin, J., Batra-Safferling, R. & Jaeger, K. E. (2016). FEBS Open Bio, 6, 484-493.]) were cultivated overnight in Luria–Bertani (LB) medium supplemented with tetracycline (100 µg ml−1) at 37°C (Table 1[link]). This culture was used to inoculate an expression culture in LB medium supplemented with tetracycline (100 µg ml−1) to an initial OD580 nm of 0.05. The cultures were grown at 37°C until they reached an OD580 nm of ∼1. The cells were harvested by centrifugation (15 min at 6750g and 4°C), resuspended in 100 mM Tris–HCl buffer pH 8 and disrupted using a French press. PA2949 was purified from the membrane fraction by immobilized metal-affinity chromatography (IMAC) using Ni–NTA agarose (Qiagen, Hilden, Germany) as described previously (Kovacic, Bleffert et al., 2016[Kovacic, F., Bleffert, F., Caliskan, M., Wilhelm, S., Granzin, J., Batra-Safferling, R. & Jaeger, K. E. (2016). FEBS Open Bio, 6, 484-493.]), with the modification that the Triton X-100 in the elution buffer was replaced by 30 mM n-octyl β-D-glucoside (OG). The PA2949 samples eluted from the Ni–NTA column were transferred into 100 mM Tris–HCl buffer pH 8 supplemented with 30 mM n-octyl β-D-glucoside (OG) by gel filtration using a PD-10 column (GE Healthcare, Solingen, Germany) according to the manufacturer's protocol. This PA2949 sample was loaded onto an anion-exchange chromatography column containing UNOsphere Q medium (Bio-Rad Laboratories, Munich, Germany) equilibrated with 100 mM Tris–HCl pH 8 buffer containing 30 mM OG. Purified PA2949 was collected in the flowthrough fraction and the protein impurities were retained on the column. The purified PA2949 was stored at room temperature.

Table 1
PA2949 production information

Source organism P. aeruginosa PA01
DNA source P. aeruginosa PA01
Forward primer (5′–3′) AAACATATGAAACGATTCCTC
Reverse primer (5′–3′) TCAGAGCTCCACCACCACCACCACCACGCGACCGGCCAC
Cloning vector pBBR1mcs-3
Expression vector pBBR-pa2949 (Kovacic, Bleffert et al., 2016[Kovacic, F., Bleffert, F., Caliskan, M., Wilhelm, S., Granzin, J., Batra-Safferling, R. & Jaeger, K. E. (2016). FEBS Open Bio, 6, 484-493.])
Cloning host E. coli DH5α
Expression host P. aeruginosa PA01
PA2949-His6 amino-acid sequence MKRFLLGLVLLLAVAAGVLYFVPATLLASVRTVERGLAGLSEHSVQVDNLEIAYLEGGSEKNPTLLLIHGFGADKDNWLRFARPLTERYHVVALDLPGFGDSSKPQQASYDVGTQAERVANFAAAIGVRRLHLAGNSMGGHIAALYAARHPEQVLSLALIDNAGVMPARKSELFEDLERGENPLVVRQPEDFQKLLDFVFVQQPPLPAPLKRYLGERAVAASAFNAQIFEQLRQRYIPLEPELPKIEAPTLLLWGDRDRVLDVSSIEVMRPLLKRPSVVIMENCGHVPMVERPEETAQHYQAFLDGVRNAQVAGRHHHHHHEL
†The sequences encoding NdeI and SacI restriction sites are underlined and that encoding the C-terminal His6 tag is in bold.

2.2. SDS–PAGE, preparation of antisera and immunodetection

Proteins were analyzed by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) under denaturating conditions on 12%(w/v) gels as described by Laemmli (1970[Laemmli, U. K. (1970). Nature (London), 227, 680-685.]). SDS–PAGE slices containing PA2949 were used to raise polyclonal antisera in rabbits (Eurogentec, Seraing, Belgium) by injecting 100 µg antigen four times over three months. The proteins transferred from the SDS–PAGE gel to PVDF membranes by Western blotting (Yuen et al., 1989[Yuen, S. W., Chui, A. H., Wilson, K. J. & Yuan, P. M. (1989). Biotechniques, 7, 74-83.]) were detected using anti-PA2949 specific antiserum according to the following procedure. The PVDF membrane with transferred proteins was saturated for 1 h in 25 mM Tris–HCl buffer pH 8 containing 150 mM NaCl, 3 mM KCl, 0.2%(v/v) Tween-20 and 5%(w/v) skimmed milk, followed by incubation with anti-PA2949 antiserum diluted 5000 times with the same buffer as used for saturation. The membrane was washed three times with 25 mM Tris–HCl buffer pH 8 containing 150 mM NaCl, 3 mM KCl and 0.2%(v/v) Tween-20, incubated for 1 h with goat anti-rabbit immunoglobulin G antibodies coupled to HRP (horseradish peroxidase; Sigma, St Louis, USA) according to the manufacturer's instructions, washed again three times with 25 mM Tris–HCl buffer pH 8 containing 150 mM NaCl, 3 mM KCl and 0.2%(v/v) Tween-20, and then exposed with an ECL Western blotting detection kit (Amersham Bioscience, Freiburg). The protein concentration was determined by measuring the A280 nm using a NanoDrop 2000c spectrophotometer (ThermoFisher Scientific Inc., Waltham, Massachusetts, USA) and using an extinction coefficient ( = 22 920 M−1 cm−1) for PA2949 with a His6 tag calculated using the ProtParam tool (Navia-Paldanius et al., 2012[Navia-Paldanius, D., Savinainen, J. R. & Laitinen, J. T. (2012). J. Lipid Res. 53, 2413-2424.]).

2.3. Enzyme-activity assays

Enzyme activities towards fatty-acid esters of p-nitrophenol (p-NP) were determined according to a previously described method (Kovacic, Bleffert et al., 2016[Kovacic, F., Bleffert, F., Caliskan, M., Wilhelm, S., Granzin, J., Batra-Safferling, R. & Jaeger, K. E. (2016). FEBS Open Bio, 6, 484-493.]). The enzymatic reactions were performed in a 96-well microplate by adding 5 µl (8 nM) of enzyme sample to 150 µl of the substrate. The kinetic parameters Km and kcat were determined by measuring the PA2949 activity with 0.05. 0.1, 0.2, 0.3, 0.5 and 1 mM p-nitrophenyl butyrate; the data were fitted to the Michaelis–Menten equation using a nonlinear regression method.

Triacylglyceride (Sigma, Taufkirchen, Germany) and 2-AG (Avanti, Alabaster, USA) substrates were prepared for enzyme-activity assays (25 µl enzyme + 25 µl substrate) as described previously (Jaeger & Kovacic, 2014[Jaeger, K. E. & Kovacic, F. (2014). Methods Mol. Biol. 1149, 111-134.]). The amount of fatty acids released by PA2949 was determined using a NEFA-HR(2) kit (Wako Chemicals, Neuss, Germany).

2.4. Thermal stability

Fluorescence-based thermal stability experiments were performed using a Prometheus NT.48 from NanoTemper Technologies. Capillaries containing 10 µl PA2949 sample were inserted into the machine, the temperature was increased from 20 to 90°C at a rate of 1°C min−1, and the fluorescence was measured at emission wavelengths of 330 and 350 nm. Enzyme activity-based thermal unfolding experiments were performed by measuring the residual esterase activity of a PA2949 sample incubated for 1 h at temperatures from 30 to 70°C. The enzyme assay was performed as described above using p-NPC4 substrate. The ratio of fluorescence intensities at 350 and 330 nm (for the biophysical method) and esterase activities (for the biochemical method) as a function of temperature were used to determine the transition temperatures, which can be interpreted as the melting temperatures.

2.5. Crystallization and data collection

For crystallization, purified PA2949 was concentrated to 3.5 mg ml−1 using an ultrafiltration device with a 30 kDa molecular-weight cutoff membrane. Initial crystallization screening was performed with the AmSO4, CubicPhase I and CubicPhase II, MbClass, PEGs I and PEGs II Suites (Qiagen, Hilden, Germany), Crystal Screen and Crystal Screen 2 (Hampton Research, Aliso Viejo, California, USA) and Wizard Screens 1 and 2 (Emerald BioStructures, Bainbridge Island, Washington, USA) crystallization screening kits at 19°C using the sitting-drop vapor-diffusion method (Table 2[link]). The PA2949 crystals used for X-ray diffraction were grown from a solution consisting of 1 µl PA2949 solution and 1 µl reservoir solution [100 mM trisodium citrate pH 5.6 with 10%(w/v) PEG 4000 and 10%(w/v) propan-2-ol]. Crystals appeared within three weeks. Before cryocooling, single crystals were soaked stepwise in reservoir solution containing up to 15%(w/v) polyethylene glycol 200. The X-ray diffraction data were recorded on beamline ID23-1 at the European Synchrotron Radiation Facility, Grenoble, France using a wavelength of 0.9791 Å. The data-collection strategies, taking radiation damage into account, were based on calculations using BEST (Bourenkov & Popov, 2010[Bourenkov, G. P. & Popov, A. N. (2010). Acta Cryst. D66, 409-419.]). Data processing was carried out using XDS (Kabsch, 2010[Kabsch, W. (2010). Acta Cryst. D66, 125-132.]) and AIMLESS (which is part of the CCP4 software package; Winn et al., 2011[Winn, M. D., Ballard, C. C., Cowtan, K. D., Dodson, E. J., Emsley, P., Evans, P. R., Keegan, R. M., Krissinel, E. B., Leslie, A. G. W., McCoy, A., McNicholas, S. J., Murshudov, G. N., Pannu, N. S., Potterton, E. A., Powell, H. R., Read, R. J., Vagin, A. & Wilson, K. S. (2011). Acta Cryst. D67, 235-242.]). Structure determination is currently being performed by molecular replacement.

Table 2
Crystallization conditions

Method Sitting-drop vapor diffusion
Plate type NeXtal Evolution μplate (Qiagen, Hilden, Germany)
Temperature (°C) 19
Protein concentration (mg ml−1) 3.5
Buffer composition of protein solution 100 mM Tris–HCl pH 8, 30 mM OG
Composition of reservoir solution 100 mM trisodium citrate pH 5.6 with 10%(w/v) PEG 4000 and 10%(w/v) propan-2-ol
Volume, ratio of drop 2 µl, 1:1
Volume of reservoir (µl) 70

3. Results and discussion

3.1. Similarity of P. aeruginosa PA2949 and human ABHD6

Previously, we have described P. aeruginosa PA2949 as a membrane-bound esterase that is homologous to bacterial esterases/lipases (Kovacic, Bleffert et al., 2016[Kovacic, F., Bleffert, F., Caliskan, M., Wilhelm, S., Granzin, J., Batra-Safferling, R. & Jaeger, K. E. (2016). FEBS Open Bio, 6, 484-493.]). PA2949 shows 27% sequence identity and 49% sequence similarity to the human α/β-hydrolase domain 6 (ABHD6) protein, which exerts lipase activity (Blankman et al., 2007[Blankman, J. L., Simon, G. M. & Cravatt, B. F. (2007). Chem. Biol. 14, 1347-1356.]; Fig. 1[link]a). Secondary-structure prediction revealed a similar organization of eight β-strands and ten α-helices in both proteins (Fig. 1[link]b). Sequence analysis revealed conservation of Ser137 in PA2949 and Ser148 in ABHD6, which yielded inactive enzymes when mutated to alanine (Kovacic, Bleffert et al., 2016[Kovacic, F., Bleffert, F., Caliskan, M., Wilhelm, S., Granzin, J., Batra-Safferling, R. & Jaeger, K. E. (2016). FEBS Open Bio, 6, 484-493.]; Navia-Paldanius et al., 2012[Navia-Paldanius, D., Savinainen, J. R. & Laitinen, J. T. (2012). J. Lipid Res. 53, 2413-2424.]). Inhibition experiments with PA2949 and ABHD6 revealed similar inhibition profiles with respect to the typical lipase inhibitor tetrahydrolipstatin (THL; Ašler et al., 2007[Ašler, I. L., Zehl, M., Kovačić, F., Müller, R., Abramić, M., Allmaier, G. & Kojić-Prodić, B. (2007). Biochim. Biophys. Acta, 1770, 163-170.]) and the arylesterase inhibitor phenylmethyl­sulfonyl fluoride (PMSF; Blankman et al., 2007[Blankman, J. L., Simon, G. M. & Cravatt, B. F. (2007). Chem. Biol. 14, 1347-1356.]; Kovacic, Bleffert et al., 2016[Kovacic, F., Bleffert, F., Caliskan, M., Wilhelm, S., Granzin, J., Batra-Safferling, R. & Jaeger, K. E. (2016). FEBS Open Bio, 6, 484-493.]). Furthermore, the other two putative members of the catalytic triad (His and Asp) and the putative oxyanion-hole residues (Met and Phe) are strictly conserved between the two enzymes (Fig. 1[link]). The putative acyltransferase motif (HXXXXD, where X represents any residue) reported for ABHD6 (Lord et al., 2013[Lord, C. C., Thomas, G. & Brown, J. M. (2013). Biochim. Biophys. Acta, 1831, 792-802.]) is also conserved in PA2949 (Fig. 1[link]a). Although promiscuous enzymes with lipase and acyltransferase activities have previously been described (Brumlik & Buckley, 1996[Brumlik, M. J. & Buckley, J. T. (1996). J. Bacteriol. 178, 2060-2064.]; Vijayaraj et al., 2012[Vijayaraj, P., Jashal, C. B., Vijayakumar, A., Rani, S. H., Venkata Rao, D. K. & Rajasekharan, R. (2012). Plant Physiol. 160, 667-683.]), the acyltransferase activity of ABHD6 and PA2949 still needs to be demonstrated experimentally. Prediction of cellular localization revealed a putative N-terminal transmembrane (TM) domain (Fig. 1[link]), which is likely to serve as a signal anchor, in both proteins (Kovacic, Bleffert et al., 2016[Kovacic, F., Bleffert, F., Caliskan, M., Wilhelm, S., Granzin, J., Batra-Safferling, R. & Jaeger, K. E. (2016). FEBS Open Bio, 6, 484-493.]; Lord et al., 2013[Lord, C. C., Thomas, G. & Brown, J. M. (2013). Biochim. Biophys. Acta, 1831, 792-802.]). This suggestion is supported by the experimentally demonstrated membrane localization of PA2949 and ABHD6 (Blankman et al., 2007[Blankman, J. L., Simon, G. M. & Cravatt, B. F. (2007). Chem. Biol. 14, 1347-1356.]; Kovacic, Bleffert et al., 2016[Kovacic, F., Bleffert, F., Caliskan, M., Wilhelm, S., Granzin, J., Batra-Safferling, R. & Jaeger, K. E. (2016). FEBS Open Bio, 6, 484-493.]). To conclude, comparison of the sequence properties of PA2949 and ABHD6 revealed substantial similarity despite the considerable evolutionary distance between them.

[Figure 1]
Figure 1
Sequence alignment of P. aeruginosa PA2949 with human ABHD6 and secondary-structure prediction. (a) Sequence alignment. The putative active site comprising the catalytic triad (Ser148, His306 and Asp278 in ABHD6, and Ser137, His286 and Asp258 in PA2949) and the oxyanion-hole residues (Phe80 and Met149 in ABHD6, and Phe71 and Met138 in PA2949) are indicated by red triangles and circles, respectively. Conserved residues (His99 and Asp104 in ABHD6 and His90 and Asp95 in PA2949) of the putative HXXXXD acyltransferase motif are indicated by red squares. The putative transmembrane domains of PA2949 (amino acids 4–24) and ABHD6 (amino acids 9–29) are indicated by red lines above and below the sequences, respectively. Identical and similar residues are shaded in black and yellow, respectively. The pairwise sequence alignment was generated with the EMBOSS Water (Rice et al., 2000[Rice, P., Longden, I. & Bleasby, A. (2000). Trends Genet. 16, 276-277.]) local alignment tool from the European Bioinformatics Institute (EMBL–EBI). (b) Secondary structure was predicted with the JPred4 server (Drozdetskiy et al., 2015[Drozdetskiy, A., Cole, C., Procter, J. & Barton, G. J. (2015). Nucleic Acids Res. 43, W389-W394.]) using a method based on hidden Markov models. α-Helices are indicated in red and β-sheets in green.

3.2. Optimized expression and purification procedure for P. aeruginosa PA2949

For the crystallographic characterization of PA2949, we attempted to purify milligram amounts of PA2949 under conditions where it retains activity during the time frame of the crystallization experiments. Our previously published system for the expression of PA2949 in E. coli BL21(DE3) cells (Kovacic, Bleffert et al., 2016[Kovacic, F., Bleffert, F., Caliskan, M., Wilhelm, S., Granzin, J., Batra-Safferling, R. & Jaeger, K. E. (2016). FEBS Open Bio, 6, 484-493.]) and purification by immobilized metal-affinity chromatography in the presence of Triton X-100 yielded a protein that showed a loss of enzymatic activity after storage at 4 or −20°C in the presence or absence of glycerol (data not shown). To overcome the protein stability issue, we tested whether the homologous host P. aeruginosa might be more suitable for the expression of membrane-bound PA2949 than a heterologous host. We developed the P. aeruginosa PA01 system for induction-independent constitutive expression of PA2949 controlled by a moderate lac promoter on the pBBR1mcs-3 plasmid. P. aeruginosa PA01 cells carrying the pBBR-pa2949 plasmid (Kovacic, Bleffert et al., 2016[Kovacic, F., Bleffert, F., Caliskan, M., Wilhelm, S., Granzin, J., Batra-Safferling, R. & Jaeger, K. E. (2016). FEBS Open Bio, 6, 484-493.]) expressed catalytically active PA2949 in the late logarithmic and stationary phases. While the esterase activity was constant during growth, degradation of intracellular PA2949 in the stationary-phase culture was observed as judged from Western blot analysis (Fig. 2[link]). Consequently, for purification purposes cells were harvested in the late log­arithmic phase (an OD580 nm of ∼1) to avoid the degradation of PA2949 observed in cultures with an OD580 nm of 2 (Fig. 2[link]).

[Figure 2]
Figure 2
Expression of PA2949 in P. aeruginosa. P. aeruginosa PA01 strain carrying pBBR1mcs-3 (empty-vector control, dashed line) or pBBR-pa2949 (solid line) was grown in LB medium at 37°C; cells were collected at five (1–5) different growth stages (the respective OD580 nm values are indicated above the arrows). Cells equivalent to 100 µl of culture with an OD580 nm of 1 were analyzed by SDS–PAGE and the presence of PA2949 in each sample was tested by Western blotting using anti-His-tag antibodies. Purified PA2949 (+C) was used as a positive control.

The selection of a detergent to provide stable conditions for membrane proteins after their extraction from bacterial membranes is essential for subsequent characterization. The mild, non-ionic detergent Triton X-100, widely used for solubilizing proteins from membranes (Schnaitman, 1971[Schnaitman, C. A. (1971). J. Bacteriol. 108, 545-552.]; Slinde & Flatmark, 1976[Slinde, E. & Flatmark, T. (1976). Biochim. Biophys. Acta, 455, 796-805.]), showed a good performance in solubilizing P. aeruginosa membranes (Kovacic, Bleffert et al., 2016[Kovacic, F., Bleffert, F., Caliskan, M., Wilhelm, S., Granzin, J., Batra-Safferling, R. & Jaeger, K. E. (2016). FEBS Open Bio, 6, 484-493.]). However, denaturation of a membrane protein can be caused by Triton X-100 owing to suboptimal stabilization of the TM domains (Seddon et al., 2004[Seddon, A. M., Curnow, P. & Booth, P. J. (2004). Biochim. Biophys. Acta, 1666, 105-117.]; Garavito & Ferguson-Miller, 2001[Garavito, R. M. & Ferguson-Miller, S. (2001). J. Biol. Chem. 276, 32403-32406.]), destabilization of extramembranous soluble domains (Yang et al., 2014[Yang, Z., Wang, C., Zhou, Q., An, J., Hildebrandt, E., Aleksandrov, L. A., Kappes, J. C., DeLucas, L. J., Riordan, J. R., Urbatsch, I. L., Hunt, J. F. & Brouillette, C. G. (2014). Protein Sci. 23, 769-789.]) or by reactive peroxides that are products of the oxidation and hydrolysis of Triton X-100 (Ashani & Catravas, 1980[Ashani, Y. & Catravas, G. N. (1980). Anal. Biochem. 109, 55-62.]; Moraes et al., 2014[Moraes, I., Evans, G., Sanchez-Weatherby, J., Newstead, S. & Shaw Stewart, P. D. (2014). Biochim. Biophys. Acta, 1838, 78-87.]). For these reasons, we applied the mild, non-ionic detergent OG, commonly used in membrane-protein research (Moraes et al., 2014[Moraes, I., Evans, G., Sanchez-Weatherby, J., Newstead, S. & Shaw Stewart, P. D. (2014). Biochim. Biophys. Acta, 1838, 78-87.]; Arolas et al., 2014[Arolas, J. L., García-Castellanos, R., Goulas, T., Akiyama, Y. & Gomis-Rüth, F. X. (2014). Protein Expr. Purif. 99, 113-118.]), to PA2949. The PA2949 sample eluted from the IMAC column using a buffer that contains OG showed the presence of other protein impurities (Fig. 3[link]), as also observed for purification from E. coli (Kovacic, Bleffert et al., 2016[Kovacic, F., Bleffert, F., Caliskan, M., Wilhelm, S., Granzin, J., Batra-Safferling, R. & Jaeger, K. E. (2016). FEBS Open Bio, 6, 484-493.]). We next purified PA2949 by anion-exchange chromatography to a homogeneity that was sufficient for further biochemical and crystallographic studies (Fig. 3[link]). The OG-stabilized PA2949 protein retained more than 56% of its esterase activity, as measured with p-nitrophenyl (p-NP) hexanoate (C6) substrate, after storage at room temperature for six months. The thermal stability of PA2949 in OG was studied by measuring the change in intrinsic protein fluorescence upon thermal unfolding and by measuring the residual esterase activity after the exposure of PA2949 to different temperatures. These experiments revealed melting temperatures of PA2949 of 43.4 ± 0.5 and 53.1 ± 0.4°C calculated from enzyme-activity and fluorescence measurements, respectively (Fig. 4[link]). It is likely that differences in the experimental setup (1 h of incubation in the enzymatic method versus continuous heating in the nanoDSF method) led to the observed discrepancy in the melting temperatures.

[Figure 3]
Figure 3
Purification of PA2949 from P. aeruginosa. (a) P. aeruginosa PA01 cells carrying the pa2949 expression vector (pBBR-pa2949) or pBBR1mcs-3 (EV, empty vector) were harvested at an OD580 nm of 1 and disrupted. Membranes (M) were separated by ultracentrifugation. PA2949 was purified with an Ni–NTA column and subsequently with a UNOsphere Q anion-exchange column (AEx) in the presence of n-octyl β-D-glucoside. The samples were analyzed by SDS–PAGE stained with Coomassie Brilliant Blue G-250. The molecular weights of protein standards (St) are indicated on the right in kDa.
[Figure 4]
Figure 4
Thermal stability of PA2949 in OG buffer measured by determination of enzymatic activity (a) and change in intrinsic fluorescence (b). The relative esterase activity and the derivative of esterase activity (ΔActivity/ΔT) as a function of temperature are shown in the upper and lower panels, respectively. 100% activity corresponds to the highest measured activity of PA2949. The fluorescence ratio (F350 nm/F330 nm) and the derivative of the fluorescence ratio [Δ(F350 nm/F330 nm)/ΔT] as a function of temperature are shown in the upper and lower diagrams, respectively. Dashed lines indicate calculated melting temperatures. Enzyme-activity results represent measurements of three independent experiments each with at least three samples. Standard deviations were within 10%. The fluorescence-based unfolding result is a representative single curve.

3.3. Substrate specificity of P. aeruginosa PA2949

PA2949 purified from P. aeruginosa in the presence of OG showed a 2.3-fold higher esterase activity than the enzyme purified from E. coli with Triton X-100 (198.8 ± 5.1 U mg−1; Kovacic, Bleffert et al., 2016[Kovacic, F., Bleffert, F., Caliskan, M., Wilhelm, S., Granzin, J., Batra-Safferling, R. & Jaeger, K. E. (2016). FEBS Open Bio, 6, 484-493.]) using p-NPC6 as a substrate (Table 3[link]). Substrate-specificity measurements revealed the highest activity of PA2949 to be with p-NP octanoate (C8), and that the activity declines with increasing length of the fatty-acid acyl chain to reach no measurable activity with p-NP stearate (C18) (Table 3[link]). PA2949 hydrolyses natural triacyl­glycerol substrates with a similar specificity as p-NP esters, although its activity with triglycerides was lower (Table 3[link]). Apparently, PA2949 shows a typical activity profile for esterases that are capable of releasing medium-chain fatty acids from water-soluble carboxylic esters (Leščic Ašler et al., 2010[Leščić Ašler, I., Ivić, N., Kovačić, F., Schell, S., Knorr, J., Krauss, U., Wilhelm, S., Kojić-Prodić, B. & Jaeger, K.-E. (2010). ChemBioChem, 11, 2158-2167.]; Kovacic, Mandrysch et al., 2016[Kovacic, F., Mandrysch, A., Poojari, C., Strodel, B. & Jaeger, K. E. (2016). Protein Eng. Des. Sel. 29, 65-76.]; Chow et al., 2012[Chow, J., Kovacic, F., Dall Antonia, Y., Krauss, U., Fersini, F., Schmeisser, C., Lauinger, B., Bongen, P., Pietruszka, J., Schmidt, M., Menyes, I., Bornscheuer, U. T., Eckstein, M., Thum, O., Liese, A., Mueller-Dieckmann, J., Jaeger, K. E. & Streit, W. R. (2012). PLoS One, 7, e47665.]; Ali et al., 2012[Ali, Y. B., Verger, R. & Abousalham, A. (2012). Methods Mol. Biol. 861, 31-51.]). Kinetics measurements of the hydrolysis of a typical esterase substrate, p-NP butyrate (C4), revealed that PA2949 follows Michaelis–Menten kinetics, as reported for most esterases (Fig. 5[link]). Interestingly, ABHD6 also hydrolyses TAG substrates and shows a preference for esters with medium-chain acyl chains (from C8 to C14; Navia-Paldanius et al., 2012[Navia-Paldanius, D., Savinainen, J. R. & Laitinen, J. T. (2012). J. Lipid Res. 53, 2413-2424.]). However, in vitro measurements showed a high activity of ABHD6 against the natural substrate 2-AG, which contains a long-chain fatty acid of 20 C atoms and four unsaturated bonds (Navia-Paldanius et al., 2012[Navia-Paldanius, D., Savinainen, J. R. & Laitinen, J. T. (2012). J. Lipid Res. 53, 2413-2424.]). Our results with purified PA2949 demonstrated that the enzyme rapidly releases the fatty acid from the 2-AG substrate with an activity of 12.2 ± 0.3 nanomoles of fatty acid per milligram of PA2949 per minute. This activity is in the region of the activity reported for ABHD6 (7.4 ± 0.5 nanomoles of fatty acid per milligram of ABHD6 per minute), although these measurements were performed with lysates of human cells transiently expressing ABHD6 (Navia-Paldanius et al., 2012[Navia-Paldanius, D., Savinainen, J. R. & Laitinen, J. T. (2012). J. Lipid Res. 53, 2413-2424.]). To conclude, the substrate profiling of PA2949 suggests that PA2949 and ABHD6 are biochemically similar, which is in agreement with the sequence similarity and the similarities in their inhibition results and cellular localization. Although the role of arachidonic acid as a precursor of signaling messengers in eukary­otes has been established, limited data are available on its presence and function in prokaryotes (Bajpai & Bajpai, 1992[Bajpai, P. & Bajpai, P. K. (1992). Biotechnol. Appl. Biochem. 15, 1-10.]; Martínez & Campos-Gómez, 2016[Martínez, E. & Campos-Gómez, J. (2016). Nat. Commun. 7, 13823.]). The physiological relevance of the 2-AG hydrolase activity of PA2949 still needs to be elucidated.

Table 3
Substrate specificities of PA2949 with p-nitrophenyl (p-NP) esters and triacylglycerides (TAG)

Acyl-chain length p-NP activity (U mg−1) TAG activity (mU mg−1)
C2 108.9 ± 6.5 NA
C4 520.4 ± 31.7 NA
C6 458.0 ± 11.5 10.1 ± 0.2
C8 621.2 ± 34.2 ND
C10 351.3 ± 25.5 12.6 ± 0.2
C12 162.5 ± 12.5 3.9 ± 0.2
C14 58.9 ± 19.4 0.3 ± 0.1
C16 18.4 ± 5.1 NA
C18 NA NA
†All values are the mean ± standard deviation of three independent measurements of each set in triplicate. NA, not active; ND, not determined.
[Figure 5]
Figure 5
Enzyme kinetics of PA2949. The esterase activity of PA2949 (8 nM) purified with OG was measured using pNP C4, and kinetic parameters (± standard deviation) were determined by nonlinear regression analysis of data fitted to the Michaelis–Menten equation. The results represent measurements from eight independent experiments.

3.4. Crystallization of PA2949

Proteins with a single TM domain are considered to be difficult to crystallize, which is the reason why few structures of them are available (Monk et al., 2014[Monk, B. C., Tomasiak, T. M., Keniya, M. V., Huschmann, F. U., Tyndall, J. D., O'Connell, J. D., Cannon, R. D., McDonald, J. G., Rodriguez, A., Finer-Moore, J. S. & Stroud, R. M. (2014). Proc. Natl Acad. Sci. USA, 111, 3865-3870.]; Ray et al., 2018[Ray, L. C., Das, D., Entova, S., Lukose, V., Lynch, A. J., Imperiali, B. & Allen, K. N. (2018). Nat. Chem. Biol. 14, 538-541.]). The concentrated PA2949 sample (3.5 mg ml−1) was centrifuged (21 000g, 10 min) prior to performing crystallization setups. Single crystals were obtained using the sitting-drop vapor-diffusion method at 19°C after a few rounds of fine screening around the buffer conditions described in Section 2[link]. Tetragonal crystals of approximate dimensions 180 × 40 × 40 µm grew after an equilibration period of three weeks (Fig. 6[link]). These crystals diffracted to 2.54 Å resolution. Data processing revealed the space group to be I4122, with unit-cell parameters a = b = 135.36, c = 205.29 Å, α = β = γ = 90°. A summary of the X-ray crystallographic data-collection statistics is presented in Table 4[link]. The calculated Matthews coefficient and the solvent content were 2.9 Å3 Da−1 and 58%, respectively. This suggests the presence of two molecules in the asymmetric unit of the PA2949 crystals. Currently, we are fine-tuning the crystallization conditions to improve the quality of the crystals for successful structure determination using the molecular-replacement method. The high-resolution crystal structure of PA2949 will provide information on the α/β-hydrolase class of proteins, which could be important in order to understand their structure–function relationship.

Table 4
X-ray diffraction data-collection and processing statistics for PA2949

Values in parentheses are for the highest resolution shell.

Beamline ID23-1
Detector PILATUS 6M
Wavelength (Å) 0.9791
Resolution range (Å) 47.86–2.54 (2.65–2.54)
Space group I4122
a, b, c (Å) 135.36, 135.36, 205.29
α, β, γ (°) 90, 90, 90
Total reflections 179853
Unique reflections 31637 (3807)
Multiplicity 5.7 (5.9)
Completeness (%) 99.7 (99.9)
Mean I/σ(I) 8.8 (1.3)
Wilson B factor (Å2) 45.91
Rmerge 0.148 (1.656)
Rmeas 0.162 (1.813)
Rp.i.m. 0.067 (0.730)
Mn(I) half-set correlation CC1/2 0.994 (0.419)
Expected No. of molecules in asymmetric unit 2
Solvent fraction (%) 58
Matthews coefficient (Å3 Da−1) 2.9
[Figure 6]
Figure 6
Crystal and initial X-ray diffraction pattern of PA2949. (a) A tetragonal PA2949 crystal in a loop prepared for collection of the diffraction pattern. (b) X-ray diffraction pattern from a reference set of two images taken with a resolution of ∼2.8 Å (edge of the detector) with a maximum φ separation of 90° with Δφ = 1°. The optimal strategy for data collection was determined based on these images using MOSFLM (Winn et al., 2011[Winn, M. D., Ballard, C. C., Cowtan, K. D., Dodson, E. J., Emsley, P., Evans, P. R., Keegan, R. M., Krissinel, E. B., Leslie, A. G. W., McCoy, A., McNicholas, S. J., Murshudov, G. N., Pannu, N. S., Potterton, E. A., Powell, H. R., Read, R. J., Vagin, A. & Wilson, K. S. (2011). Acta Cryst. D67, 235-242.]) and BEST (Bourenkov & Popov, 2010[Bourenkov, G. P. & Popov, A. N. (2010). Acta Cryst. D66, 409-419.]). The given resolution for data collection was 2.5 Å (for results, see Table 4[link]).

Acknowledgements

We are grateful to the beamline scientists at the European Synchrotron Radiation Facility, Grenoble, France for assisting with the use of beamline ID23-1. We acknowledge Vinko Misetic and Moran Jerabek from NanoTemper Technologies GmbH, Munich, Germany for providing the device for thermal stability measurements.

Funding information

This study was supported by Deutsche Forschungsgemein­schaft grant CRC1208 (projects A02 and A03).

References

First citationAli, Y. B., Verger, R. & Abousalham, A. (2012). Methods Mol. Biol. 861, 31–51.  CrossRef Google Scholar
First citationArolas, J. L., García-Castellanos, R., Goulas, T., Akiyama, Y. & Gomis-Rüth, F. X. (2014). Protein Expr. Purif. 99, 113–118.  CrossRef CAS Google Scholar
First citationAshani, Y. & Catravas, G. N. (1980). Anal. Biochem. 109, 55–62.  CrossRef CAS Google Scholar
First citationAšler, I. L., Zehl, M., Kovačić, F., Müller, R., Abramić, M., Allmaier, G. & Kojić-Prodić, B. (2007). Biochim. Biophys. Acta, 1770, 163–170.  Google Scholar
First citationBajpai, P. & Bajpai, P. K. (1992). Biotechnol. Appl. Biochem. 15, 1–10.  CrossRef CAS Google Scholar
First citationBlankman, J. L., Simon, G. M. & Cravatt, B. F. (2007). Chem. Biol. 14, 1347–1356.  Web of Science CrossRef PubMed CAS Google Scholar
First citationBofill, C., Prim, N., Mormeneo, M., Manresa, A., Javier Pastor, F. I. & Diaz, P. (2010). Biochimie, 92, 307–316.  CrossRef CAS Google Scholar
First citationBourenkov, G. P. & Popov, A. N. (2010). Acta Cryst. D66, 409–419.  Web of Science CrossRef CAS IUCr Journals Google Scholar
First citationBowman, A. L. & Makriyannis, A. (2013). Chem. Biol. Drug Des. 81, 382–388.  CrossRef CAS Google Scholar
First citationBrumlik, M. J. & Buckley, J. T. (1996). J. Bacteriol. 178, 2060–2064.  CrossRef CAS Google Scholar
First citationChow, J., Kovacic, F., Dall Antonia, Y., Krauss, U., Fersini, F., Schmeisser, C., Lauinger, B., Bongen, P., Pietruszka, J., Schmidt, M., Menyes, I., Bornscheuer, U. T., Eckstein, M., Thum, O., Liese, A., Mueller-Dieckmann, J., Jaeger, K. E. & Streit, W. R. (2012). PLoS One, 7, e47665.  CrossRef Google Scholar
First citationDrozdetskiy, A., Cole, C., Procter, J. & Barton, G. J. (2015). Nucleic Acids Res. 43, W389–W394.  Web of Science CrossRef CAS PubMed Google Scholar
First citationFeledziak, M., Lambert, D. M., Marchand-Brynaert, J. & Muccioli, G. G. (2012). Recent Pat. CNS Drug. Discov. 7, 49–70.  CrossRef CAS Google Scholar
First citationFernández-Ruiz, J., Romero, J. & Ramos, J. A. (2015). Handb. Exp. Pharmacol. 231, 233–259.  Google Scholar
First citationFlores-Díaz, M., Monturiol-Gross, L., Naylor, C., Alape-Girón, A. & Flieger, A. (2016). Microbiol. Mol. Biol. Rev. 80, 597–628.  Google Scholar
First citationFolkesson, A., Jelsbak, L., Yang, L., Johansen, H. K., Ciofu, O., Høiby, N. & Molin, S. (2012). Nat. Rev. Microbiol. 10, 841–851.  CrossRef CAS Google Scholar
First citationGaravito, R. M. & Ferguson-Miller, S. (2001). J. Biol. Chem. 276, 32403–32406.  Web of Science CrossRef PubMed CAS Google Scholar
First citationHeikinheimo, P., Goldman, A., Jeffries, C. & Ollis, D. L. (1999). Structure, 7, R141–R146.  Web of Science CrossRef PubMed CAS Google Scholar
First citationJaeger, K. E. & Kovacic, F. (2014). Methods Mol. Biol. 1149, 111–134.  CrossRef CAS Google Scholar
First citationKabsch, W. (2010). Acta Cryst. D66, 125–132.  Web of Science CrossRef CAS IUCr Journals Google Scholar
First citationKovacic, F., Bleffert, F., Caliskan, M., Wilhelm, S., Granzin, J., Batra-Safferling, R. & Jaeger, K. E. (2016). FEBS Open Bio, 6, 484–493.  CrossRef CAS Google Scholar
First citationKovacic, F., Mandrysch, A., Poojari, C., Strodel, B. & Jaeger, K. E. (2016). Protein Eng. Des. Sel. 29, 65–76.  CrossRef CAS Google Scholar
First citationLaemmli, U. K. (1970). Nature (London), 227, 680–685.  CrossRef CAS PubMed Web of Science Google Scholar
First citationLeščić Ašler, I., Ivić, N., Kovačić, F., Schell, S., Knorr, J., Krauss, U., Wilhelm, S., Kojić-Prodić, B. & Jaeger, K.-E. (2010). ChemBioChem, 11, 2158–2167.  Google Scholar
First citationLord, C. C., Thomas, G. & Brown, J. M. (2013). Biochim. Biophys. Acta, 1831, 792–802.  CrossRef CAS Google Scholar
First citationMahajan-Miklos, S., Rahme, L. G. & Ausubel, F. M. (2000). Mol. Microbiol. 37, 981–988.  CAS Google Scholar
First citationMarrs, W. R., Blankman, J. L., Horne, E. A., Thomazeau, A., Lin, Y. H., Coy, J., Bodor, A. L., Muccioli, G. G., Hu, S. S.-J., Woodruff, G., Fung, S., Lafourcade, M., Alexander, J. P., Long, J. Z., Li, W., Xu, C., Möller, T., Mackie, K., Manzoni, O. J., Cravatt, B. F. & Stella, N. (2010). Nat. Neurosci. 13, 951–957.  CrossRef CAS Google Scholar
First citationMartínez, E. & Campos-Gómez, J. (2016). Nat. Commun. 7, 13823.  Google Scholar
First citationMax, D., Hesse, M., Volkmer, I. & Staege, M. S. (2009). Cancer Sci. 100, 2383–2389.  CrossRef CAS Google Scholar
First citationMonk, B. C., Tomasiak, T. M., Keniya, M. V., Huschmann, F. U., Tyndall, J. D., O'Connell, J. D., Cannon, R. D., McDonald, J. G., Rodriguez, A., Finer-Moore, J. S. & Stroud, R. M. (2014). Proc. Natl Acad. Sci. USA, 111, 3865–3870.  CrossRef CAS Google Scholar
First citationMoraes, I., Evans, G., Sanchez-Weatherby, J., Newstead, S. & Shaw Stewart, P. D. (2014). Biochim. Biophys. Acta, 1838, 78–87.  Web of Science CrossRef CAS PubMed Google Scholar
First citationNavia-Paldanius, D., Savinainen, J. R. & Laitinen, J. T. (2012). J. Lipid Res. 53, 2413–2424.  CAS PubMed Google Scholar
First citationPérez, D., Kovacic, F., Wilhelm, S., Jaeger, K. E., García, M. T., Ventosa, A. & Mellado, E. (2012). Microbiology, 158, 2192–2203.  Google Scholar
First citationRauwerdink, A. & Kazlauskas, R. J. (2015). ACS Catal. 5, 6153–6176.  CrossRef CAS Google Scholar
First citationRay, L. C., Das, D., Entova, S., Lukose, V., Lynch, A. J., Imperiali, B. & Allen, K. N. (2018). Nat. Chem. Biol. 14, 538–541.  CrossRef CAS Google Scholar
First citationRice, P., Longden, I. & Bleasby, A. (2000). Trends Genet. 16, 276–277.  Web of Science CrossRef PubMed CAS Google Scholar
First citationSchnaitman, C. A. (1971). J. Bacteriol. 108, 545–552.  CAS Google Scholar
First citationSeddon, A. M., Curnow, P. & Booth, P. J. (2004). Biochim. Biophys. Acta, 1666, 105–117.  Web of Science CrossRef PubMed CAS Google Scholar
First citationSlinde, E. & Flatmark, T. (1976). Biochim. Biophys. Acta, 455, 796–805.  CrossRef CAS Google Scholar
First citationVan Delden, C. & Iglewski, B. H. (1998). Emerg. Infect. Dis. 4, 551–560.  CrossRef CAS Google Scholar
First citationVijayaraj, P., Jashal, C. B., Vijayakumar, A., Rani, S. H., Venkata Rao, D. K. & Rajasekharan, R. (2012). Plant Physiol. 160, 667–683.  CrossRef CAS Google Scholar
First citationWinn, M. D., Ballard, C. C., Cowtan, K. D., Dodson, E. J., Emsley, P., Evans, P. R., Keegan, R. M., Krissinel, E. B., Leslie, A. G. W., McCoy, A., McNicholas, S. J., Murshudov, G. N., Pannu, N. S., Potterton, E. A., Powell, H. R., Read, R. J., Vagin, A. & Wilson, K. S. (2011). Acta Cryst. D67, 235–242.  Web of Science CrossRef CAS IUCr Journals Google Scholar
First citationYang, Z., Wang, C., Zhou, Q., An, J., Hildebrandt, E., Aleksandrov, L. A., Kappes, J. C., DeLucas, L. J., Riordan, J. R., Urbatsch, I. L., Hunt, J. F. & Brouillette, C. G. (2014). Protein Sci. 23, 769–789.  CrossRef CAS Google Scholar
First citationYuen, S. W., Chui, A. H., Wilson, K. J. & Yuan, P. M. (1989). Biotechniques, 7, 74–83.  CAS Google Scholar
First citationZhao, S., Mugabo, Y., Ballentine, G., Attane, C., Iglesias, J., Poursharifi, P., Zhang, D., Nguyen, T. A., Erb, H., Prentki, R., Peyot, M.-L., Joly, E., Tobin, S., Fulton, S., Brown, J. M., Madiraju, S. R. M. & Prentki, M. (2016). Cell Rep. 14, 2872–2888.  CrossRef CAS Google Scholar

This is an open-access article distributed under the terms of the Creative Commons Attribution (CC-BY) Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original authors and source are cited.

Journal logoSTRUCTURAL BIOLOGY
COMMUNICATIONS
ISSN: 2053-230X
Follow Acta Cryst. F
Sign up for e-alerts
Follow Acta Cryst. on Twitter
Follow us on facebook
Sign up for RSS feeds