research communications\(\def\hfill{\hskip 5em}\def\hfil{\hskip 3em}\def\eqno#1{\hfil {#1}}\)

Journal logoSTRUCTURAL BIOLOGY
COMMUNICATIONS
ISSN: 2053-230X

Crystal structure of ATP-dependent DNA ligase from Rhizobium phage vB_RleM_P10VF

crossmark logo

aArcticZymes Technologies ASA, 9037 Tromsø, Norway, bThe Norwegian Structural Biology Centre, UiT The Arctic University of Norway, Forskningsparken 3, 9037 Tromsø, Norway, and cSchool of Science, University of Waikato, Hamilton 3216, New Zealand
*Correspondence e-mail: [email protected]

Edited by K. K. Kim, Sungkyunkwan University School of Medicine, Republic of Korea (Received 6 April 2025; accepted 7 May 2025; online 14 May 2025)

DNA ligases are foundational molecular-biological tools used for cloning and sequencing workflows, and are essential replicative enzymes for all cellular life forms as well as many viruses and bacteriophage. There is considerable interest in structurally and functionally characterizing novel DNA ligases and profiling their suitability for molecular-biological applications. Here, we report the crystal structure of the ATP-dependent DNA ligase from the Rhizobium phage vB_RleM_P10VF bound to a nicked DNA duplex determined to 2.2 Å resolution. The enzyme crystallized in the DNA-encircling conformation, arrested as a step 2 intermediate in the catalytic cycle with the adenylating cofactor transferred to the 5′-phosphate of the DNA nick. The overall structure of the DNA ligase closely resembles that of the T4 DNA ligase, including an α-helical globular DNA-binding domain. Several secondary-structural elements are abbreviated in the P10VF DNA ligase relative to the T4 DNA ligase enzyme, which may account for its lower specific activity, especially on DNA substrates containing double-stranded breaks.

1. Introduction

DNA ligases are enzymes which join breaks in the phosphodiester backbone of double-stranded DNA using an adenylate-donating cofactor: either ATP or NAD+ (Tomkinson et al., 2006[Tomkinson, A. E., Vijayakumar, S., Pascal, J. M. & Ellenberger, T. (2006). Chem. Rev. 106, 687-699.]). The ATP-dependent class of DNA ligases are widespread in biology and are found in all archaea and eukaryotes as well as a large number of bacteria and viruses (Williamson et al., 2016[Williamson, A., Hjerde, E. & Kahlke, T. (2016). Mol. Microbiol. 99, 274-290.]; Pergolizzi et al., 2016[Pergolizzi, G., Wagner, G. K. & Bowater, R. P. (2016). Biosci. Rep. 36, 00391.]). The DNA ligases of viruses, and in particular those from bacteriophages, have played a central role in the development of molecular-biological workflows (Lohman et al., 2011[Lohman, G. J. S., Tabor, S. & Nichols, N. M. (2011). Curr. Protoc. Mol. Biol. 94, 3.14.1-3.14.7.]). This includes the original procedure for generating recombinant DNA in vitro using restriction-ligation cloning (Weiss & Richardson, 1967[Weiss, B. & Richardson, C. C. (1967). Proc. Natl Acad. Sci. USA, 57, 1021-1028.]) through to more recent innovations in DNA assembly such as the Gibson (isothermal assembly) and Golden Gate (Type IIS cloning) methodologies (Gibson et al., 2009[Gibson, D. G., Young, L., Chuang, R. Y., Venter, J. C., Hutchison, C. A. & Smith, H. O. (2009). Nat. Methods, 6, 343-345.]; Potapov et al., 2018[Potapov, V., Ong, J. L., Kucera, R. B., Langhorst, B. W., Bilotti, K., Pryor, J. M., Cantor, E. J., Canton, B., Knight, T. F., Evans, T. C. Jr & Lohman, G. J. S. (2018). ACS Synth. Biol. 7, 2665-2674.]). The most widely used commercial DNA ligase is T4 DNA ligase, although other viral enzymes have found niche applications. These include T3 DNA ligase, which exhibits salt tolerance, T7 DNA ligase, which preferentially ligase nicks and cohesive ends, providing extra stringency, and Chlorella virus ligase, which is sold as SplintR Ligase and is used in the detection of specific RNA sequences due to its ability to ligate adjacent DNA strands which are annealed to an RNA complement (Lohman et al., 2011[Lohman, G. J. S., Tabor, S. & Nichols, N. M. (2011). Curr. Protoc. Mol. Biol. 94, 3.14.1-3.14.7.]; Bauer et al., 2017[Bauer, R. J., Zhelkovsky, A., Bilotti, K., Crowell, L. E., Evans, T. C. Jr, McReynolds, L. A. & Lohman, G. J. S. (2017). PLoS One, 12, e0190062.]). A recently described DNA ligase from Chronobacter phage, supplied commercially as R2D Ligase, has the unique ability to ligate an RNA strand to either end of a DNA strand when annealed to a DNA template and may find applications in sequencing technologies (Gundesø et al., 2024[Gundesø, S. E., Rothweiler, U., Heimland, E., Piotrowski, Y., Rødum, I. K., Söderberg, J. J., Gábor, I. M., Solstad, T., Williamson, A., Lanes, O. & Striberny, B. K. (2024). Biotechnol. J. 19, 2300711.]).

T4 DNA ligase is an essential enzyme in the replicative lifecycle of the T4 bacteriophage, where it functions to join Okazaki fragments in conjunction with RNaseH (Miller et al., 2003[Miller, E. S., Kutter, E., Mosig, G., Arisaka, F., Kunisawa, T. & Rüger, W. (2003). Microbiol. Mol. Biol. Rev. 67, 86-156.]). The crystal structure of T4 DNA ligase showed that it possesses an α-helical DNA-binding (DB) domain which is appended to the N-terminus of its core catalytic nucleotide-transferase (NTase) and oligonucleotide-binding (OB) domains (Shi et al., 2018[Shi, K., Bohl, T. E., Park, J., Zasada, A., Malik, S., Banerjee, S., Tran, V., Li, N., Yin, Z., Kurniawan, F., Orellana, K. & Aihara, H. (2018). Nucleic Acids Res. 46, 10474-10488.]). Together, these three domains form an encircling clamp around the DNA duplex which is completed by noncovalent interactions between the DB and OB domains. This mode of encirclement is broadly common to almost all structurally characterized DNA ligases, although it may be achieved by different domain architectures, including DB domains that contain β-structures, C-terminal globular domains or unstructured `latch' regions which protrude form the core domains (Williamson & Leiros, 2020[Williamson, A. & Leiros, H.-K. S. (2020). Nucleic Acids Res. 48, 8225-8242.]). The globular DB domain of T4 is the `archetypal' helical DB domain of DNA ligases, which is also found in the archaeal replicative DNA ligases and larger eukaryotic ligases, including the three human forms (Shi et al., 2018[Shi, K., Bohl, T. E., Park, J., Zasada, A., Malik, S., Banerjee, S., Tran, V., Li, N., Yin, Z., Kurniawan, F., Orellana, K. & Aihara, H. (2018). Nucleic Acids Res. 46, 10474-10488.]).

Given the widespread use of bacteriophage DNA ligases in molecular biology, there is considerable interest in exploring the diversity of structure and function among additional bacteriophage DNA ligases. Here, we present the crystal structure of the ATP-dependent DNA ligase from Rhizobium phage vB_RleM_P10VF (P10VF-Lig), which has substantial structural similarity to T4 DNA ligase as well as to the ATP-dependent DNA ligase from the cyanobacterium Prochloro­coccus marinus (Pmar-LigP), despite having low overall sequence identity to either protein.

2. Materials and methods

2.1. Macromolecule production

The gene encoding the DNA ligase P10VF-Lig from Rhizobium phage vB_RleM_P10VF (YP_009099956) was synthesized by GeneArt (Life Technologies) with codon optimization for expression in Escherichia coli. The clonal gene, which also encoded an N-terminal cleavage site for the Tobacco etch virus (TEV) protease, was purchased pre-cloned into pDONR221 entry vectors and then subcloned into the pDEST17 expression vector using Gateway recombination.

Production of selenomethionine (SeMet)-substituted P10VF-Lig for crystallization was performed by cultivation of E. coli BL21(DE3) pLysS cells in M9 minimal medium at 37°C until an OD600 of 0.4 was reached. After this time, supplementary amino acids were added at the following concentrations: L-lysine, L-phenylalanine and L-threonine at 100 mg ml−1, isoleucine, L-leucine and L-valine at 50 mg ml−1 and L-selenomethinone at 60 mg ml−1. Cultivation was continued for 1 h at 37°C; the temperature was then decreased to 15°C and expression was induced by the addition of 0.1 mM isopropyl β-D-thiogalactopyranoside and allowed to proceed overnight. SeMet-substituted P10VF-Lig was purified and detagged as described for the native protein (Section S1). Pooled protein-containing fractions after gel filtration were concentrated to 200 µM and flash-frozen in liquid nitrogen before storage at −80°C.

Synthetic DNA oligonucleotides were ordered from Integrated DNA Technologies (IDT) with HPLC purification. A 2′-O-methylation (2′-O-Me) modification was included one nucleotide upstream from the 3′-terminus of the nick as this substrate has been successfully used to co-crystallize other DNA ligase–DNA substrate complexes (Nair et al., 2007[Nair, P. A., Nandakumar, J., Smith, P., Odell, M., Lima, C. D. & Shuman, S. (2007). Nat. Struct. Mol. Biol. 14, 770-778.]; Nandakumar et al., 2007[Nandakumar, J., Nair, P. A. & Shuman, S. (2007). Mol. Cell, 26, 257-271.]). Macromolecule-production information is summarized in Table 1[link].

Table 1
Macromolecule-production information

M indicates selenomethionine substitution; (P) indicates 5′-phosphorylation of the subsequent nucleotide; (2-Ome) indicates 2′-O-methylation of the preceding nucleotide.

Source organism Rhizobium phage vB_RleM_P10VF
DNA source Synthetic
Cloning vector pDONR221
Expression vector pDEST17
Expression host E. coli BL21(DE3) pLysS
Complete amino-acid sequence of the construct produced GLDIFSDNVSEINRISDIINSDLQAIADSKGTNAKKVELAKISEYTFKCFVFHLDPFQNFGISKLSKDAGGGEGIDWSTVFKLLYEGKGRDLKKRDKSLTTLQAKIINGIFDGFMDWKPGVKGGSFLDVFPDSYRTFEVQKCANWDPDLFEANSFAQIKFDGIRCVAMVDHNGNLTYVSRNGKPVVNIDPRIEENMKLHPGWCFDAEADSPAKFQKTSGISRASKSGSNIKLTLRVFDAIPYDAFLARKYDVQYIERYNDLKSMWSNNPFLFDLIADHTLVETWEDAQKFYEDSRANGNEGAIVKKRFGTYNFGRDDSWMKVKPLETIEARIIGYEEGKPKTKHVGRVGALIVQDYTGAISRVGSGMSDKERQYIYDNWDEFENALCEVKFMERTESGVFRHSRLSKIRLDKDDMNPTGA
DNA sequence of oligonucleotide Complement: TTCCGACAGTGGGGTCGCAAT
3′ of nick: ATTGCGACC(2-Ome)C
5′ of nick: (P)CACTATCGGAA

2.2. Crystallization

To generate the nicked DNA duplex, single oligonucleotides were resuspended at 9 mM in annealing buffer (50 mM Tris pH 8.0, 50 mM NaCl, 1 mM EDTA), mixed in a 1:1:1 ratio to give a final duplex concentration of 3 mM and incubated at 85°C before cooling overnight. P10VF-Lig was incubated with 1.2 molar equivalents of nicked duplex and 5 mM additional EDTA for 30 min on ice to form the protein–DNA complex. Crystals were grown by the hanging-drop diffusion method at 4°C from 24% PEG 4000, 100 mM bis-Tris pH 5.5 and appeared within a few days. Crystals were cryoprotected in mother liquor with an additional 12% ethylene glycol and were flash-cooled in liquid nitrogen. Crystallization information is summarized in Table 2[link].

Table 2
Crystallization

Method Vapour diffusion, hanging drop
Plate type 24-well VDXm plate
Temperature (K) 278
Protein concentration (mg ml−1) 10
Buffer composition of protein solution 50 mM Tris pH 7.5, 200 mM NaCl, 1 mM β-mercaptoethanol
Composition of reservoir solution 24% PEG 4000, 100 mM bis-Tris pH 5.5
Volume and ratio of drop 2 µl + 2 µl
Volume of reservoir (µl) 500 

2.3. Data collection and processing

Diffraction data to 2.2 Å resolution were measured on beamline 14.1 at BESSY II, Berlin. The crystal was cooled to 100 K and data were recorded on a Dectris PILATUS3 6M detector using X-rays at a wavelength of 0.979839 Å. Data were integrated, scaled and truncated in XDSapp (Kabsch, 2010[Kabsch, W. (2010). Acta Cryst. D66, 125-132.]) and merged using AIMLESS (Evans & Murshudov, 2013[Evans, P. R. & Murshudov, G. N. (2013). Acta Cryst. D69, 1204-1214.]). Data-collection and processing statistics are summarized in Table 3[link].

Table 3
Data collection and processing

Diffraction source BESSY beamline 14.1
Wavelength (Å) 0.979839
Temperature (K) 100
Detector Dectris PILATUS3 6M
Crystal-to-detector distance (mm) 458.87
Rotation range per image (°) 0.1
Total rotation range (°) 720
Exposure time per image (s) 0.08
Space group P212121
a, b, c (Å) 68.04, 100.39, 107.69
α, β, γ (°) 90, 90, 90
Mosaicity (°) 0.078
Resolution range (Å) 50–2.2 (2.3–2.2)
Total No. of reflections 989031
No. of unique reflections 72435
Completeness (%) 99.7 (98.3)
Multiplicity 13
I/σ(I)〉 19.56
Rmeas (%) 9.5
Overall B factor from Wilson plot (Å2) 54.13
†The I/σ(I) in the outer shell is 1.84. It falls below 2 in the second outermost shell at 2.33 Å resolution. The I/σ(I) in the second outermost shell is 3.22. The resolution cutoff was chosen by XDSapp (Kabsch, 2010[Kabsch, W. (2010). Acta Cryst. D66, 125-132.]).

2.4. Structure solution and refinement

The complex structure of SeMet P10VF-Lig was solved by single-wavelength anomalous diffraction (SAD) using phenix.autosol and further refined with phenix.refine (Afonine et al., 2012[Afonine, P. V., Grosse-Kunstleve, R. W., Echols, N., Headd, J. J., Moriarty, N. W., Mustyakimov, M., Terwilliger, T. C., Urzhumtsev, A., Zwart, P. H. & Adams, P. D. (2012). Acta Cryst. D68, 352-367.]; Terwilliger et al., 2009[Terwilliger, T. C., Adams, P. D., Read, R. J., McCoy, A. J., Moriarty, N. W., Grosse-Kunstleve, R. W., Afonine, P. V., Zwart, P. H. & Hung, L.-W. (2009). Acta Cryst. D65, 582-601.]) with iterative rounds of model building in Coot (Emsley et al., 2010[Emsley, P., Lohkamp, B., Scott, W. G. & Cowtan, K. (2010). Acta Cryst. D66, 486-501.]). The I/σ(I) in the outer shell is 1.84. It falls below 2 in the second outermost shell at 2.33 Å resolution. The I/σ(I) in the second outermost shell is 3.22. The resolution cutoff was chosen by XDSapp (Kabsch, 2010[Kabsch, W. (2010). Acta Cryst. D66, 125-132.]). Refinement statistics are summarized in Table 4[link].

Table 4
Structure refinement

Resolution range (Å) 47.5–2.2 (2.3–2.2)
Completeness (%) 99.6
σ Cutoff F > 1.34σ(F)
No. of reflections, working set 72380 (4496)
No. of reflections, test set 2089 (134)
Final Rcryst 0.205 (0.3709)
Final Rfree 0.246 (0.3869)
No. of non-H atoms
 Protein 3114
 Nucleic acid 857
 Ligand 36
 Water 184
 Total 4191
R.m.s.d., bond lengths (Å) 0.003
R.m.s.d., angles (°) 0.548
Average B factors (Å2)
 Protein 53.2
 Nucleic acid 63.6
 Ligand 50.5
 Water 56.2
Ramachandran plot
 Most favoured (%) 97
 Allowed (%) 3

3. Results and discussion

The P10VF-Lig DNA ligase was crystallized in the closed conformation bound to nicked DNA. Analysis of the overall structure revealed that the DNA duplex was encircled by the three globular domains: the highly conserved NTase domain, C-terminal OB domain and N-terminal DB domain (Fig. 1[link]a). As anticipated, the latter domain comprises eight α-helices, with the majority of the protein–DNA contacts from this domain being formed by inter-helical loops (Fig. 1[link]b).

[Figure 1]
Figure 1
Overall structure of P10VF-Lig bound to nicked DNA. (a) DNA ligase shown as a surface. (b) DNA ligase rendered as a cartoon to show secondary-structure elements. (c) Detailed view of the 5′ DNA–adenylate `step 2' intermediate captured in the crystal structure. (d) Detailed view of noncovalent interactions between the DB and OB domains which complete the encirclement of the DNA duplex by P10VF-Lig. In all figures the DNA-binding domain is coloured gold, the nucleotidyl transferase domain is coloured red and the oligonucleotide-binding domain is coloured teal. DNA is shown in grey and AMP in green.

The complex has crystallized as the `step 2' intermediate of the DNA ligase reaction where the AMP moiety has been transferred from the active site of the ligase enzyme to the 5′-phosphate of the DNA substrate (Fig. 1[link]c). This intermediate has been crystallized in a number of other DNA ligase–DNA substrate co-crystal structures (Shi et al., 2018[Shi, K., Bohl, T. E., Park, J., Zasada, A., Malik, S., Banerjee, S., Tran, V., Li, N., Yin, Z., Kurniawan, F., Orellana, K. & Aihara, H. (2018). Nucleic Acids Res. 46, 10474-10488.]; Williamson & Leiros, 2019[Williamson, A. & Leiros, H.-K. S. (2019). Nucleic Acids Res. 47, 7147-7162.]; Williamson et al., 2018[Williamson, A., Grgic, M. & Leiros, H.-K. S. (2018). Nucleic Acids Res. 46, 8616-8629.]) and is considered to result from covalent adenylation (step 1 reaction) of the DNA ligase enzyme during protein purification prior to its addition to the crystallization experiment. The encirclement of the nicked DNA duplex is completed by noncovalent interactions between side chains of the DB domain (Asp116 and Lys118) and OB domain (Lys341) (Fig. 1[link]d).

Structural alignment of P10VF-Lig with T4 DNA ligase revels that the latter has a more extensive binding surface with the DNA substrate (Fig. 2[link]). This is reflected in the relative buried solvent-accessible surface areas of the DNA substrate by each protein, with only 901 Å of the DNA substrate (18.3%) interfacing with the P10VF-Lig protein, compared with 1406 Å (29.2% of the DNA duplex) buried by the T4-DNA ligase protein (Supplementary Table S2). This discrepancy is due to differences in helix 4 of the DB domain, which is truncated and kinked in P10VF-Lig relative to the equivalent secondary structure in T4 DNA ligase (Fig. 2[link]b, i), as well as two loops in the OB domain of T4 DNA ligase (Fig. 2[link]b, iii). The NTase domain of T4 DNA ligase also contains additional helical elements relative to P10VF-Lig which insert into the minor groove on the 3′-end of the DNA nick. In P10VF-Lig the equivalent 17 residues between Ala212 and Asn229 have no visible density (Fig. 2[link]b, ii). In T4 DNA ligase, this region also contains an unstructured gp45 clamp-binding motif which has previously been shown to facilitate interaction between the clamp and the ligase, potentially increasing the processivity of the enzyme; however, there is no equivalent clamp-binding motif in the sequence of P10VF-Lig (Supplementary Fig. S1).

[Figure 2]
Figure 2
(a) Structural overlay of P10VF-Lig (blue) with T4 DNA ligase (yellow), highlighting the relatively more extensive surface of the T4 enzyme. DNA in this view (grey) is shown for the P10VF-Lig structure only, but is essentially identical to the T4 DNA ligase structure when superimposed. (b) Structural overlay of P10VF-Lig with T4 DNA ligase for individual domains rendered in cartoon mode to highlight secondary-structural elements. Features which are present in T4 DNA ligase but absent in P10VF-Lig are coloured red. DNA adenylate is shown for the P10VF-Lig structure only.

P10VF-Lig DNA ligase was originally selected for in vitro characterization on the basis that it aligns with T4 DNA ligase and other T4-like DNA ligases for the entirety of its amino-acid sequence, albeit with a residue identity of less than 18% (Supplementary Table S1). Given the widespread use of bacteriophage enzymes in molecular biology, we aimed to determine whether T4 DNA ligase homologs such as P10VF-Lig DNA ligase might possess similarly high activities and broad substrate ranges to the T4 DNA ligase enzyme (Bullard & Bowater, 2006[Bullard, D. R. & Bowater, R. P. (2006). Biochem. J. 398, 135-144.]). To this end, P10VF-Lig and a second novel phage-derived T4-DNA ligase homolog from Acinetobacter phage Ac42 (Ac42-Lig) were assayed on a range of ligatable DNA substrates and compared with T4 DNA ligase and the bacterial ATP-dependent DNA ligase Pmar-LigP. Despite the relatively high structural similarity between P10VF-Lig and T4 DNA ligase, P10VF-Lig exhibited considerably lower specific activity on most substrates tested, with no detectable ligation on cohesive overhangs (Fig. 3[link]). Ac42-Lig, however, exhibited robust activity on all four substrates that was comparable to that of T4 DNA ligase. This may be due to the different relative binding areas of these respective DNA ligases with the DNA substrate; Ac42-Lig has equivalent insertions in its NTase and OB domains as T4 DNA ligase, while both P10VF-Lig and Pmar-LigP have similarly abbreviated structures in these regions and both exhibit low activity on double-stranded breaks (Fig. 3[link]; Supplementary Fig. S1).

[Figure 3]
Figure 3
DNA-ligation activity of different DNA breaks by T4-like DNA ligase enzymes. The Nick substrate contained a break on a single strand of the DNA duplex. The overhang substrate contained a cohesive double-stranded break with a four base-pair overhang, the TA + PEG substrate contained a cohesive double-stranded break with a single T–A overhang and included 10%(w/v) PEG 3350, and the Blunt + PEG substrate contained a double-stranded break without any cohesive overhang and included 10%(w/v) PEG 3350. Details of the assay conditions are given in Section S2. Values represent the mean of duplicate measurements and error bars represent the standard deviation from the mean.

In conclusion, our structural and functional analysis of these T4 DNA-ligase homologs indicates that the differing abilities of DNA ligases to join DNA substrates may be due to relatively subtle changes in their binding surfaces. This validates the analysis of DNA ligase–DNA substrate complexes as part of a comprehensive strategy towards the discovery or design of better DNA ligase enzymes. Such insight may prove especially powerful in the context of ever-improving structural modelling by allowing high-throughput models to be benchmarked against validated crystal structures of biochemically characterized DNA ligase enzymes. Such comprehensive information will be useful to inform sequence-based bio-discovery endeavours, as well as structure-guided design strategies.

4. Related literature

The following references are cited in the supporting information for this article: Krissinel & Henrick (2007[Krissinel, E. & Henrick, K. (2007). J. Mol. Biol. 372, 774-797.]), Robert & Gouet (2014[Robert, X. & Gouet, P. (2014). Nucleic Acids Res. 42, W320-W324.]) and Stelzer et al. (2024[Stelzer, R., Rzoska-Smith, E., Gundesø, S., Rothweiler, U. & Williamson, A. (2024). J. Vis. Exp., e66930.]).

Supporting information


Acknowledgements

We acknowledge the provision of synchrotron beam time at the BESSY II electron-storage ring operated by Helmholtz- Zentrum Berlin.

Funding information

Funding for this research was provided by: Norges Forskningsråd (grant No. 247732 to Adele Williamson); Royal Society Te Apārangi (Rutherford Discovery Fellowship 20-UOW-004 to Adele Williamson).

References

First citationAfonine, P. V., Grosse-Kunstleve, R. W., Echols, N., Headd, J. J., Moriarty, N. W., Mustyakimov, M., Terwilliger, T. C., Urzhumtsev, A., Zwart, P. H. & Adams, P. D. (2012). Acta Cryst. D68, 352–367.  Web of Science CrossRef CAS IUCr Journals Google Scholar
First citationBauer, R. J., Zhelkovsky, A., Bilotti, K., Crowell, L. E., Evans, T. C. Jr, McReynolds, L. A. & Lohman, G. J. S. (2017). PLoS One, 12, e0190062.  CrossRef PubMed Google Scholar
First citationBullard, D. R. & Bowater, R. P. (2006). Biochem. J. 398, 135–144.  CrossRef PubMed CAS Google Scholar
First citationEmsley, P., Lohkamp, B., Scott, W. G. & Cowtan, K. (2010). Acta Cryst. D66, 486–501.  Web of Science CrossRef CAS IUCr Journals Google Scholar
First citationEvans, P. R. & Murshudov, G. N. (2013). Acta Cryst. D69, 1204–1214.  Web of Science CrossRef CAS IUCr Journals Google Scholar
First citationGibson, D. G., Young, L., Chuang, R. Y., Venter, J. C., Hutchison, C. A. & Smith, H. O. (2009). Nat. Methods, 6, 343–345.  Web of Science CrossRef PubMed CAS Google Scholar
First citationGundesø, S. E., Rothweiler, U., Heimland, E., Piotrowski, Y., Rødum, I. K., Söderberg, J. J., Gábor, I. M., Solstad, T., Williamson, A., Lanes, O. & Striberny, B. K. (2024). Biotechnol. J. 19, 2300711.  Google Scholar
First citationKabsch, W. (2010). Acta Cryst. D66, 125–132.  Web of Science CrossRef CAS IUCr Journals Google Scholar
First citationKrissinel, E. & Henrick, K. (2007). J. Mol. Biol. 372, 774–797.  Web of Science CrossRef PubMed CAS Google Scholar
First citationLohman, G. J. S., Tabor, S. & Nichols, N. M. (2011). Curr. Protoc. Mol. Biol. 94, 3.14.1–3.14.7.  CrossRef Google Scholar
First citationMiller, E. S., Kutter, E., Mosig, G., Arisaka, F., Kunisawa, T. & Rüger, W. (2003). Microbiol. Mol. Biol. Rev. 67, 86–156.  Web of Science CrossRef PubMed CAS Google Scholar
First citationNair, P. A., Nandakumar, J., Smith, P., Odell, M., Lima, C. D. & Shuman, S. (2007). Nat. Struct. Mol. Biol. 14, 770–778.  Web of Science CrossRef PubMed CAS Google Scholar
First citationNandakumar, J., Nair, P. A. & Shuman, S. (2007). Mol. Cell, 26, 257–271.  Web of Science CrossRef PubMed CAS Google Scholar
First citationPergolizzi, G., Wagner, G. K. & Bowater, R. P. (2016). Biosci. Rep. 36, 00391.  Web of Science CrossRef PubMed Google Scholar
First citationPotapov, V., Ong, J. L., Kucera, R. B., Langhorst, B. W., Bilotti, K., Pryor, J. M., Cantor, E. J., Canton, B., Knight, T. F., Evans, T. C. Jr & Lohman, G. J. S. (2018). ACS Synth. Biol. 7, 2665–2674.  CrossRef CAS PubMed Google Scholar
First citationRobert, X. & Gouet, P. (2014). Nucleic Acids Res. 42, W320–W324.  Web of Science CrossRef CAS PubMed Google Scholar
First citationShi, K., Bohl, T. E., Park, J., Zasada, A., Malik, S., Banerjee, S., Tran, V., Li, N., Yin, Z., Kurniawan, F., Orellana, K. & Aihara, H. (2018). Nucleic Acids Res. 46, 10474–10488.  CrossRef CAS PubMed Google Scholar
First citationStelzer, R., Rzoska-Smith, E., Gundesø, S., Rothweiler, U. & Williamson, A. (2024). J. Vis. Exp., e66930.  Google Scholar
First citationTerwilliger, T. C., Adams, P. D., Read, R. J., McCoy, A. J., Moriarty, N. W., Grosse-Kunstleve, R. W., Afonine, P. V., Zwart, P. H. & Hung, L.-W. (2009). Acta Cryst. D65, 582–601.  Web of Science CrossRef CAS IUCr Journals Google Scholar
First citationTomkinson, A. E., Vijayakumar, S., Pascal, J. M. & Ellenberger, T. (2006). Chem. Rev. 106, 687–699.  Web of Science CrossRef PubMed CAS Google Scholar
First citationWeiss, B. & Richardson, C. C. (1967). Proc. Natl Acad. Sci. USA, 57, 1021–1028.  CrossRef CAS PubMed Google Scholar
First citationWilliamson, A., Grgic, M. & Leiros, H.-K. S. (2018). Nucleic Acids Res. 46, 8616–8629.  CrossRef CAS PubMed Google Scholar
First citationWilliamson, A., Hjerde, E. & Kahlke, T. (2016). Mol. Microbiol. 99, 274–290.  CrossRef CAS PubMed Google Scholar
First citationWilliamson, A. & Leiros, H.-K. S. (2019). Nucleic Acids Res. 47, 7147–7162.  CrossRef CAS PubMed Google Scholar
First citationWilliamson, A. & Leiros, H.-K. S. (2020). Nucleic Acids Res. 48, 8225–8242.  CrossRef CAS PubMed Google Scholar

This is an open-access article distributed under the terms of the Creative Commons Attribution (CC-BY) Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original authors and source are cited.

Journal logoSTRUCTURAL BIOLOGY
COMMUNICATIONS
ISSN: 2053-230X
Follow Acta Cryst. F
Sign up for e-alerts
Follow Acta Cryst. on Twitter
Follow us on facebook
Sign up for RSS feeds